Tuyển chọn chủng vi sinh vật có khả năng ức chế nấm neoscytalidium dimidiatum gây bệnh đốm nâu thanh long

Tài liệu Tuyển chọn chủng vi sinh vật có khả năng ức chế nấm neoscytalidium dimidiatum gây bệnh đốm nâu thanh long: Hội thảo Quốc gia về Khoa học Cây trồng lần thứ hai  1167 TUYỂN CHỌN CHỦNG VI SINH VẬT CÓ KHẢ NĂNG ỨC CHẾ NẤM Neoscytalidium dimidiatum GÂY BỆNH ĐỐM NÂU THANH LONG Hà Thị Thúy, Lương Hữu Thành, Vũ Thúy Nga, Hứa Thị Sơn, Tống Hải Vân Viện Môi trường Nông nghiệp TÓM TẮT Nghiên cứu ứng dụng vi sinh vật kiểm soát bệnh đốm nâu trên cây thanh long do nấm Neoscytalidium dimidiatum gây ra có ý nghĩa quan trọng hướng tới ngành sản xuất thanh long an toàn và bền vững. Trong bài viết này nhóm nghiên cứu đã xác định được hai chủng vi sinh vật có khả năng ức chế nấm Neoscytalidium dimidiatum cao kí hiệu là A3, B7. Kết quả phân loại xác định chủng A3 thuộc nhóm xạ khuẩn 3 tương đồng 100% (1500/1500 bp) với đoạn ADNr 16S của Streptomyces fradiae; chủng B7 tương đồng 100% (1414/1414 bp) với đoạn 16S của vi khuẩn Bacillus polyfermenticus và đảm bảo an toàn sinh học khi phóng thích ra môi trường. Từ khóa: Bệnh đốm nâu, thanh long, Neoscytalidium dimidiatum, Streptomyces fradia...

pdf6 trang | Chia sẻ: quangot475 | Lượt xem: 211 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Tuyển chọn chủng vi sinh vật có khả năng ức chế nấm neoscytalidium dimidiatum gây bệnh đốm nâu thanh long, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Hội thảo Quốc gia về Khoa học Cây trồng lần thứ hai  1167 TUYỂN CHỌN CHỦNG VI SINH VẬT CÓ KHẢ NĂNG ỨC CHẾ NẤM Neoscytalidium dimidiatum GÂY BỆNH ĐỐM NÂU THANH LONG Hà Thị Thúy, Lương Hữu Thành, Vũ Thúy Nga, Hứa Thị Sơn, Tống Hải Vân Viện Môi trường Nông nghiệp TÓM TẮT Nghiên cứu ứng dụng vi sinh vật kiểm soát bệnh đốm nâu trên cây thanh long do nấm Neoscytalidium dimidiatum gây ra có ý nghĩa quan trọng hướng tới ngành sản xuất thanh long an toàn và bền vững. Trong bài viết này nhóm nghiên cứu đã xác định được hai chủng vi sinh vật có khả năng ức chế nấm Neoscytalidium dimidiatum cao kí hiệu là A3, B7. Kết quả phân loại xác định chủng A3 thuộc nhóm xạ khuẩn 3 tương đồng 100% (1500/1500 bp) với đoạn ADNr 16S của Streptomyces fradiae; chủng B7 tương đồng 100% (1414/1414 bp) với đoạn 16S của vi khuẩn Bacillus polyfermenticus và đảm bảo an toàn sinh học khi phóng thích ra môi trường. Từ khóa: Bệnh đốm nâu, thanh long, Neoscytalidium dimidiatum, Streptomyces fradiae, Bacillus polyfermenticus I. ĐẶT VẤN ĐỀ Thanh long là một trong những cây ăn quả cho giá trị xuất khẩu cao, được trồng nhiều ở Bình Thuận, Long An, Tiền Giang. Tuy nhiên trong những năm gần đây dịch hại là nguyên nhân làm giảm năng suất, chất lượng sản phẩm đặc biệt là bệnh đốm nâu trên cây thanh long do nấm Neoscytalidium dimidiatum (thuộc họ Botryosphaeriaceae; bộ Botryosphaeriales; lớp nấm túi Ascomycetes) gây ra. Hiện tại tình trạng bệnh đang diễn biến rất phức tạp, lây lan nhanh trên diện rộng, phát triển mạnh vào mùa mưa. Sử dụng hóa chất bảo vệ thực vật có gốc Azoxystrobin, Sifenoconazole... kiểm soát bệnh đốm nâu thanh long tương đối hiệu quả, tuy nhiên dư lượng thuốc bảo vệ thực vật trong sản phẩm là rào cản lớn nhất để xuất khẩu thanh long ra các thị trường khó tính như EU, Mỹ, Nhật... Nghiên cứu sử dụng vi sinh vật làm tác nhân sinh học kiểm soát bệnh đốm nâu thanh long là một hướng nghiên cứu tích cực đáp ứng được yêu cầu về sản phẩm an toàn để xuất khẩu, tiêu dùng trong nước cũng như góp phần hạn chế sử dụng hóa chất trong sản xuất nông nghiệp. II. VẬT LIỆU PHƯƠNG PHÁP NGHIÊN CỨU 2.1. Vật liệu nghiên cứu - Nấm Neoscytalidium dimidiatum được Viện cây ăn quả Miền Nam cung cấp. - Mẫu đất được lấy ở Bình Thuận, Tiền Giang, Long An. - Hóa chất và các thiết bị cần thiết trong phân tích, đánh giá vi sinh vật. 2.2. Phương pháp nghiên cứu 2.2.1. Xác định mật độ vi sinh vật: Dựa trên phương pháp nuôi cấy trên môi trường thạch đĩa, tính số lượng vi sinh vật trên ml hoặc trên gam mẫu thông qua số khuẩn lạc phát triển trong các đĩa môi trường. 2.2.2. Xác định hoạt tính sinh học (khả năng ức chế nấm): Hoạt tính sinh học của các chủng vi sinh vật theo phương pháp đo vòng khuyếch tán trên môi trường thạch. 2.2.3. Phương pháp xác định tên, an toàn sinh học của vi sinh vật: Sử dụng kỹ thuật sinh học phân tử giải trình tự đoạn gen 16s ARN riboxom của các chủng vi sinh vật nghiên cứu, so sánh với các trình tự có sẵn trong ngân hàng gen quốc tế EMBL bằng phương pháp FASTA 33 để định loại đến loài các chủng vi sinh vật. Cặp mồi được thiết kế dựa trên trình tự đoạn gen mã hóa 16s ARN riboxom của chủng E. coli (JO1695), tương ứng với các vị trí nucleotit 15-33 (cho mồi xuôi) và 1548-1532 (cho mồi ngược). Trình tự nucleotit của các chủng nghiên cứu được giải trình trên máy tự động ABI-377 của Hãng Perkin-Elmer (Mỹ), sau đó được xử lý bằng chương trình SeqEd1.03 và chương trình AssemblyLING 1.9 trong quan hệ chương trình MacVector 6.5.3 (Oxford Molecular Inc.). Truy cập gen bằng chương trình Entrez / nucleotid/ tìm kiếm các trình tự gen 16s ARN riboxom của vi khuẩn. So sánh đối chiếu và xử lý số liệu của tất cả các chuỗi bằng chương trình GENDOC2.5. Thành VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM 1168 phần nucleotit được thu nhận bằng cách sử dụng bộ mã của vi sinh vật bậc thấp (vi khuẩn) trong Ngân hàng Gen (bảng mã di truyền số 11) thông qua chương trình GENDOC 2.2.4. Tên vi sinh vật được xác định với xác suất tương đồng cao nhất: Đối chiếu với danh mục các loài vi sinh vật an toàn của Cộng đồng Châu Âu cũng như danh mục các loài vi sinh vật bị hạn chế sử dụng để xác định tính an toàn của chủng vi sinh vật lựa chọn. III. KẾT QUẢ VÀ THẢO LUẬN 3.1. Tuyển chọn chủng vi sinh vật có khả năng ức chế nấm Neoscytalidium dimidiatum Từ các mẫu đất bị bệnh được lấy ở Bình Thuận, Long An, Tiền Giang nhóm nghiên cứu đã tiến hành phân lập và tuyển chọn được một số chủng vi sinh vật có hoạt tính ức chế nấm Neoscytalidium dimidiatum. Bảng 1. Kết quả phân lập các chủng vi sinh vật có hoạt tính ức chế nấm Neoscytalidium dimidiatum STT  Ký hiệu chủng  Nguồn gốc  Nhóm vi sinh vật Đường kính vòng ức chế nấm (D-d)mm          Vi sinh vật Đối chứng 1  B1  Bình Thuận  Xạ khuẩn 15,5±3 0 2  B6  Bình Thuận  Vi khuẩn 12,5±3 0 3  B7  Bình Thuận  Vi khuẩn 23,0±3 0 4  B4  Bình Thuận  Xạ khuẩn 15,0±3 0 5  A1  Tiền Giang  Vi khuẩn 13,0±3 0 6  A2  Tiền Giang  Vi khuẩn 16,0±3 0 7  A3  Tiền Giang  Xạ khuẩn 21,0±3 0 8  C1  Long An  Vi khuẩn 16,0±3 0 9  C3  Long An  Vi khuẩn 17,0±3 0 10  C4  Long An  Vi khuẩn 18,0±3 0 Từ mẫu đất ở Bình Thuận, Tiền Giang và Long An, nhóm nghiên cứu đã phân lập được 10 chủng vi sinh vật có hoạt tính ức chế nấm Neoscytalidium dimidiatum, trong đó có 7 chủng thuộc nhóm vi khuẩn và 3 chủng thuộc nhóm xạ khuẩn. Kết quả đánh giá hoạt tính sinh học theo phương pháp khuếch tán trên thạch đĩa cho thấy các công thức đối chứng (sử dụng nước cất khử trùng) đều không xuất hiện vòng ức chế nấm Neoscytalidium dimidiatum. Số liệu bảng 1 cho thấy chủng A1 có khả năng ức chế nấm Neoscytalidium dimidiatum thấp (đường kính vòng ức chế = 13,0mm), chủng A3 và B7 có đường kính vòng ức chế cao nhất (21,0±3 và 23,0±3 mm) và được nhóm nghiên cứu lựa chọn sử dụng làm vật liệu phục vụ cho các nghiên cứu tiếp theo. Hình 1. Hình ảnh vòng đối kháng nấm Neoscytalidium dimidiatum của chủng B7, A3 Hội thảo Quốc gia về Khoa học Cây trồng lần thứ hai  1169 3.2. Đặc điểm sinh hóa của chủng vi sinh vật nghiên cứu - Đặc điểm sinh lý, hình thái chủng B7: Khuẩn lạc B7 được nuôi cấy trên môi trường KB có hình tròn, mép hình răng cưa, màu trắng sữa. Nuôi cấy lắc trên môi trường dịch thể sau 48 giờ mật độ tế bào đạt cao nhất 7.109CFU/ml (Bảng 2). - Đặc điểm sinh lý, hình thái chủng A3: Khuẩn lạc A3 nuôi cấy trên môi trường Gauze có hình tròn, đường kính 2,2-2,5mm, màu phớt hồng, chân khuẩn lạc bám sâu trong môi trường. Nuôi cấy lắc trên môi trường dịch thể, sau 72 giờ tạo thành hạt nhỏ kích cỡ khoảng 1mm, làm trên môi trường nuôi cấy, trên thành bình tạo thành vòng váng màu trắng, bám chặt vào thành bình, mật độ tế bào đạt 2.109 CFU/ml (Bảng 2). Hình 2. Hình ảnh khuẩn lạc chủng B7, A3 Bảng 2. Điều kiện nuôi cấy thích hợp cho chủng B7, A3 sinh trưởng phát triển Điều kiện nuôi cấy  Kết quả xác địnhB7 A3  Nhiệt độ thích hợp (oC) 35±2 35±2  pH  6,0 - 7,5 6,0 - 7,5  Nhu cầu O2 (lưu lượng cấp khí (dm3 O2/ dm3 môi trường/h)  0,75  0,75  Thời gian nuôi cấy (h) 48 72  Nguồn hydratcacbon  Glycerol, tinh bột, rỉ đường Cao malt, dextrose  Nguồn Ni tơ  Pepton, cao nấm men Pepton, cao nấm men  3.3. Định danh chủng vi sinh vật sử dụng trong nghiên cứu Trình tự gen rARN 16S của chủng B7 CCTGGCTCAGGACGAACGCTGGCG GCGTGCCTAATACATGCAAGTCGAGCG GACAGATGGGAGCTTGCTCCCTGATGTT AGCGGCGGACGGGTGAGTAACACGTGG GTAACCTGCCTGTAAGACTGGGATAAC TCCGGGAAACCGGGGCTAATACCGGAT GGTTGTTTGAACCGCATGGTTCAAACAT AAAAGGTGGCTTCGGCTACCACTTACA GATGGACCCGCGGCGCATTAGCTAGTT GGTGAGGTAACGGCTCACCAAGGCAAC GATGCGTAGCCGACCTGAGAGGGTGAT CGGCCACACTGGGACTGAGACACGGCC CAGACTCCTACGGGAGGCAGCAGTAGG GAATCTTCCGCAATGGACGAAAGTCTG ACGGAGCAACGCCGCGTGAGTGATGAA GGTTTTCGGATCGTAAAGCTCTGTTGTT AGGGAAGAACAAGTACCGTTCGAATAG GGCGGTACCTTGACGGTACCTAACCAG AAAGCCACGGCTAACTACGTGCCAGCA GCCGCGGTAATACGTAGGTGGCAAGCG TTGTCCGGAATTATTGGGCGTAAAGGG CTCGCAGGCGGTTTCTTAAGTCTGATGT GAAAGCCCCCGGCTCAACCGGGGAGGG TCATTGGAAACTGGGGAACTTGAGTGC VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM 1170 AGAAGAGGAGAGTGGAATTCCACGTGT AGCGGTGAAATGCGTAGAGATGTGGAG GAACACCAGTGGCGAAGGCGACTCTCT GGTCTGTAACTGACGCTGAGGAGCGAA AGCGTGGGGAGCGAACAGGATTAGATA CCCTGGTAGTCCACGCCGTAAACGATG AGTGCTAAGTGTTAGGGGGTTTCCGCCC CTTAGTGCTGCAGCTAACGCATTAAGCA CTCCGCCTGGGGAGTACGGTCGCAAGA CTGAAACTCAAAGGAATTGACGGGGGC CCGCACAAGCGGTGGAGCATGTGGTTT AATTCGAAGCAACGCGAAGAACCTTAC CAGGTCTTGACATCCTCTGACAATCCTA GAGATAGGACGTCCCCTTCGGGGGCAG AGTGACAGGTGGTGCATGGTTGTCGTC AGCTCGTGTCGTGAGATGTTGGGTTAAG TCCCGCAACGAGCGCAACCCTTGATCTT AGTTGCCAGCATTCAGTTGGGCACTCTA AGGTGACTGCCGGTGACAAACCGGAGG AAGGTGGGGATGACGTCAAATCATCAT GCCCCTTATGACCTGGGCTACACACGTG CTACAATGGACAGAACAAAGGGCAGCG AAACCGCGAGGTTAAGCCAATCCCACA AATCTGTTCTCAGTTCGGATCGCAGTCT GCAACTCGACTGCGTGAAGCTGGAATC GCTAGTAATCGCGGATCAGCATGCCGC GGTGAATACGTTCCCGGGCCTTGTACAC ACCGCCCGTCACACCACGAGAGTTTGT AACACCCGAAGTCGGTGAGGTAACCTT TATGGAGCCAGCCGCCGAAGGTGGGAC AGATGATTGGGGTGAAGTCGTAACAAG GTAGCCGTATCGGAAGGTGCGGCTGGA TCACCTCCTTT Trình tự gen rARN 16S của chủng B7 tương đồng 100% (1414/1414 bp) với đoạn 16S của vi khuẩn Bacillus polyfermenticus; tương đồng 99,9% (1413/1414 bp) với đoạn 16S của vi khuẩn Bacillus axarquiensis, Brevibacterium halotolerans. Dựa vào kết quả xác định trình tự gen và đặc điểm sinh hóa của vi khuẩn nghiên cứu, chủng B7 có đặc điểm trùng với chủng vi khuẩn có tên Bacillus polyfermenticus. Trình tự gen rARN 16S của chủng A3 AGAGTTTGATCCTGGCTCAGGAC GAACGCTGGCGGCGTGCTTAACACATG CAAGTCGAACGATGAACCCACTTCGGT GGGGGATTAGTGGCGAACGGGTGAGTA ACACGTGGGCAATCTGCCCTGCACTCTG GGACAAGCCCTGGAAACGGGGTCTAAT ACCGGATACGACCACTTCAGGCATCTG ATGGTGGTGGAAAGCTCCGGCGGTGCA GGATGAGCCCGCGGCCTATCAGCTAGT TGGTGAGGTAACGGCTCACCAAGGCGA CGACGGGTAGCCGGCCTGAGAGGGCGA CCGGCCACACTGGGACTGAGACACGGC CCAGACTCCTACGGGAGGCAGCAGTGG GGAATATTGCACAATGGGCGAAAGCCT GATGCAGCGACGCCGCGTGAGGGATGA CGGCCTTCGGGTTGTAAACCTCTTTCAG CAGGGAAGAAGCGAAAGTGACGGTACC TGCAGAAGAAGCGCCGGCTAACTACGT GCCAGCAGCCGCGGTAATACGTAGGGC GCAAGCGTTGTCCGGAATTATTGGGCGT AAAGAGCTCGTAGGCGGCCTGTCACGT CGGATGTGAAAGCCCGGGGCTTAACCC CGGGTCTGCATTCGATACGGGCAGGCT AGAGTTCGGTAGGGGAGATCGGAATTC CTGGTGTAGCGGTGAAATGCGCAGATA TCAGGAGGAACACCGGTGGCGAAGGCG GATCTCTGGGCCGATACTGACGCTGAG GAGCGAAAGCGTGGGGAGCGAACAGG ATTAGATACCCTGGTAGTCCACGCCGTA AACGTTGGGAACTAGGTGTGGGCGAC ATTCCACGTCGTCCGTGCCGCAG CTAACGCATTAAGTTCCCCGCCTGGGGA GTACGGCCGCAAGGCTAAAACTCAAAG GAATTGACGGGGGCCCGCACAAGCGGC GGAGCATGTGGCTTAATTCGACGCAAC GCGAAGAACCTTACCAAGGCTTGACAT ACACCGGAAACACCCAGAGATGGGTGC CCCCTTGTGGTCGGTGTACAGGTGGTGC ATGGCTGTCGTCAGCTCGTGTCGTGAGA TGTTGGGTTAAGTCCCGCAACGAGCGC AACCCTTGTCCCGTGTTGCCAGCAGGCC CTTGTGGTGCTGGGGACTCACGGGAGA CCGCCGGGGTCAACTCGGAGGAAGGTG GGGACGACGTCAAGTCATCATGCCCCTT ATGTCTTGGGCTGCACACGTGCTAcAAT GGCCGGTACAAAGAGCTGCGATACCGC AAGGTGGAGCGAATCTCAAAAAGCCGG TCTCAGTTCGGATTGGGGTCTGCAACTC GACCCCATGAAGTCGGAGTCGCTAGTA ATCGCAGATCAGCATTGCTGCGGTGAA TACGTTCCCGGGCCTTGTACACACCGCC CGTCACGTCACGAAAGTCGGTAACACC CGAAGCCGGTGGCCCAACCCCTTGTGG GAGGGAGCTGTCGAAGGTGGGACTGGC GATTGGGACGAAGTCGTAACAAGGTAG CCGTACCGGAAGGTGCGGCTGGATCAC CTCCTTT Hội thảo Quốc gia về Khoa học Cây trồng lần thứ hai  1171 Trình tự ARNr 16S chủng A3 tương đồng 100% (1500/1500 bp) với đoạn ADNr 16S của Streptomyces fradiae và Streptomyces rubrolavendulae; 99,8% (1497/1500 bp) với Streptomyces roseoflavus. Dựa vào kết quả xác định trình tự gen và đặc điểm sinh hóa của xạ khuẩn nghiên cứu, chủng A3 có đặc điểm trùng với chủng xạ khuẩn có tên Streptomyces fradiae. 3.4. Xác định mức độ an toàn sinh học Theo Hướng dẫn số 90/679/EWG của Cộng đồng châu Âu về an toàn sinh học, nhóm tác nhân sinh học được phân làm 4 cấp độ an toàn, trong đó chỉ các VSV ở cấp độ 1 và 2 được ứng dụng trong sản xuất ở điều kiện bình thường. Mức an toàn sinh học 1-4 là các mức an toàn sinh học chung, chủ yếu cho các tác nhân sinh học như vi khuẩn, virut, nấm, ký sinh trùng (kể cả có và không có biến đổi gen). Kết quả đối chiếu với danh mục cho thấy chủng vi khuẩn (Bacillus polyfermenticus) và chủng xạ khuẩn (Streptomyces fradiae) được xếp vào nhóm VSV có độ an toàn sinh học mức 2, có thể ứng dụng rộng rãi trong sản xuất chế phẩm đối kháng nấm Neoscytalidium dimidiatum. IV. KẾT LUẬN VÀ KIỀN NGHỊ 4.1. Kết luận 1. Từ các mẫu thu thập tại các vùng đất trồng thanh long tại Bình Thuận, Tiền Giang, Long An nhóm nghiên cứu đã phân lập được 10 chủng vi sinh vật có hoạt tính sinh học ức chế sự sinh trưởng của nấm Neoscytali diumdimitiatum gây bệnh đốm nâu thanh long. 2. Kết quả nghiên cứu cũng cho thấy chủng A3 có đường kính vòng ức chế nấm Neoscytalidium dimitiatum là 21,0±3 mm và chủng B7 có đường kính vòng ức chế nấm Neoscytalidium dimidiatum 23,0±3 mm. Kết quả phân loại xác định chủng A3 thuộc nhóm xạ khuẩn tương đồng 100% (1500/1500 bp) với đoạn ADNr 16S của Streptomyces fradiae; chủng B7 tương đồng 100% (1414/1414 bp) với đoạn 16S của vi khuẩn Bacillus polyfermenticus. 3. Đối chiếu với kết quả xác định mức độ an toàn sinh học của các loài nấm theo Tiêu chuẩn chung của Cộng đồng châu Âu, cả 2 chủng vi sinh vật này được xếp vào nhóm vi sinh vật có độ an toàn sinh học mức 2, được phép sử dụng trong sản xuất và phóng thích ra môi trường và có thể sử dụng làm vật liệu nghiên cứu chế phẩm sinh học phòng trừ nấm Neoscytalidium dimidiatum. 4.2. Kiến nghị Đề nghị hỗ trợ kinh phí để nghiên cứu hoàn thiện công nghệ sản xuất chế phẩm vi sinh vật phòng trừ nấm Neoscytalidium dimitiatum, nhanh chóng đưa sản phẩm và ứng dụng vào trong sản xuất. LỜI CẢM ƠN Nghiên cứu này được thực hiện trong khuôn khổ thực hiện nhiệm vụ khuyến nông "Xây dựng mô hình, tuyên truyền các giải pháp cấp bách quản lý bệnh đốm nâu thanh long ở một số tỉnh Duyên Hải Nam Trung Bộ và đồng bằng Sông Cửu Long". Các tác giả trân trọng cám ơn Bộ Nông nghiệp và PTNT đã cấp kinh phí thực hiện nhiệm vụ. TÀI LIỆU THAM KHẢO 1. Trần Cẩm Vân (2004), Giáo trình vi sinh vật môi trường, NXB Đại học Quốc gia Hà Nội, Hà Nội. 2. Bộ Nông nghiệp và PTNT (2006) “Vi sinh vật – Phương pháp đánh giá hoạt tính đối kháng nấm gây bệnh vùng rễ cây trồng cạn”. 10TCN 867: 2006. 3. Cục Bảo vệ Thực vật. 2014. Tình hình sâu bệnh hại trên thanh long và giải quyết các rào cản kiểm dịch thực vật cho quả thanh long xuất khẩu của Việt Nam. Báo cáo trong Hội nghị “Sản xuất và phát triển thị trường thanh long bền vững” vào ngày 15/5/2014 tại Bình Thuận. 4. Nguyễn Thành Hiếu, Nguyễn Ngọc Anh Thư và Nguyễn Văn Hòa. 2014a. Nghiên cứu xác định tác nhân, đặc điểm hình thái và sinh học của nấm Neoscytalidium dimidiatum gây bệnh đốm nâu trên thanh long (Hylocereus undatus). Hội thảo quốc gia Bệnh hại thực vật Việt Nam lần thứ 13, tổ chức tại Trường Đại học Nông lâm TP. Hồ Chí Minh, 6-7/5/2014, 114-120. 5. Nguyễn Hồng Sơn, Nguyễn Thành Hiếu, Nguyễn Thị Bích Ngọc, Trần Minh Tiến, Mai Thị Thúy Kiều, Nguyễn Thị Thu Vinh. Kết VIỆN KHOA HỌC NÔNG NGHIỆP VIỆT NAM 1172 quả nghiên cứu một số biện pháp cấp bách để hạn chế sự lây lan và tác hại của bệnh đốm nâu thanh long do nấm Neoscytalidium dimidiatum gây ra, Tạp chí Nông nghiệp và PTNT, số 9/ 2015. Trang 27-32 6. Awang Y., Ghani M.A.A., Sijam K. and Mohamad R. B., 2011 Effect of calcium chloride on anthracnose disease and postharvest quality of red-flesh dragon fruit (Hylocereus polyzhius). African Journal of Microbiology Research Vol. 5(29), pp. 5250- 5259. 7. Amponsah, N. T, Jones, E. E, Ridgway, H. J, Jaspers, M. V. 2009. Rainwater dispersal of Botryosphaeria conidia from infected grapevines. New Zealand Plant Protection 62: 228-233. 8. Amponsah, N.T, Jones, E. E, Ridgway, H. J, Jaspers, M. V. 2008. Production of Botryosphaeria species conidia using grapevine green shoots. New Zealand Plant Protection 61: 301-305. ABSTRACT Selection of microorganisms to control brown spot caused by Neoscytalidium dimidiatum on dragon fruit A study on application of microbe to control brown spot on the dragon fruit caused by fungi Neoscytalidium dimidiatum plays an important role towards the safe and sustainable production of dragon fruit. In this study, the research team has identified two strains of microorganisms (A3, B7) highly capable of inhibiting Neoscytalidium dimidiatum. Classification results determined the actinomycete A3 homologous of 100% (1500/1500 bp) with ADNr 16S segment of Streptomyces fradiae; Strain of B7 homologous of 100% (1414/1414 bp) with Bacillus polyfermenticus and ensure biosafety when released into the environment. Keywords: Bacillus polyfermenticus, Brown spot, dragon fruit, Neoscytalidium dimidiatum, Streptomyces fradiae Người phản biện: GS. TS. Nguyễn Hồng Sơn

Các file đính kèm theo tài liệu này:

  • pdfbai_viet_185_5302_2130503.pdf
Tài liệu liên quan