Nuôi cấy và định danh vi khuẩn porphyromonas gingivalis từ mảng bám dưới nướu của bệnh nhân viêm nha chu

Tài liệu Nuôi cấy và định danh vi khuẩn porphyromonas gingivalis từ mảng bám dưới nướu của bệnh nhân viêm nha chu: Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 22 * Số 5 * 2018 178 NUÔI CẤY VÀ ĐỊNH DANH VI KHUẨN PORPHYROMONAS GINGIVALIS TỪ MẢNG BÁM DƯỚI NƯỚU CỦA BỆNH NHÂN VIÊM NHA CHU Trần Thị Phương Thảo*, Lương Thị Mỹ Ngân**, Phạm Anh Vũ Thụy*** TÓM TẮT Mục tiêu: Nuôi cấy và định danh vi khuẩn Porphyromonas gingivalis từ mảng bám dưới nướu của bệnh nhân viêm nha chu. Đối tượng - Phương pháp nghiên cứu: Vi khuẩn trong nghiên cứu này được phân lập từ mảng bám dưới nướu của bệnh nhân viêm nha chu mạn mức độ trung bình đến nặng. Môi trường nuôi cấy được sử dụng là thạch máu cừu và ủ ở 37ºC trong điều kiện kỵ khí trong 10 ngày. Sau khi xác định gram (-), hình dáng tròn và màu sắc đen đặc trưng, mẫu khuẩn lạc được gửi định danh bằng phương pháp Maldi-Tof và khẳng định kết quả bằng phương pháp PCR. Kết quả: Khuẩn lạc Porphyromonas gingivalis nuôi cấy thành công từ mẫu mảng bám dưới nướu của bệnh nhân thứ 21 có chẩn đoán viêm nha chu mạn tính thể nặng. Khuẩn lạc hình tròn, ...

pdf7 trang | Chia sẻ: Đình Chiến | Ngày: 13/07/2023 | Lượt xem: 23 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Nuôi cấy và định danh vi khuẩn porphyromonas gingivalis từ mảng bám dưới nướu của bệnh nhân viêm nha chu, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 22 * Số 5 * 2018 178 NUÔI CẤY VÀ ĐỊNH DANH VI KHUẨN PORPHYROMONAS GINGIVALIS TỪ MẢNG BÁM DƯỚI NƯỚU CỦA BỆNH NHÂN VIÊM NHA CHU Trần Thị Phương Thảo*, Lương Thị Mỹ Ngân**, Phạm Anh Vũ Thụy*** TÓM TẮT Mục tiêu: Nuôi cấy và định danh vi khuẩn Porphyromonas gingivalis từ mảng bám dưới nướu của bệnh nhân viêm nha chu. Đối tượng - Phương pháp nghiên cứu: Vi khuẩn trong nghiên cứu này được phân lập từ mảng bám dưới nướu của bệnh nhân viêm nha chu mạn mức độ trung bình đến nặng. Môi trường nuôi cấy được sử dụng là thạch máu cừu và ủ ở 37ºC trong điều kiện kỵ khí trong 10 ngày. Sau khi xác định gram (-), hình dáng tròn và màu sắc đen đặc trưng, mẫu khuẩn lạc được gửi định danh bằng phương pháp Maldi-Tof và khẳng định kết quả bằng phương pháp PCR. Kết quả: Khuẩn lạc Porphyromonas gingivalis nuôi cấy thành công từ mẫu mảng bám dưới nướu của bệnh nhân thứ 21 có chẩn đoán viêm nha chu mạn tính thể nặng. Khuẩn lạc hình tròn, dạng lồi, tiêu huyết β, mặt láng, kích thước 1 - 2mm và có màu đen đặc trưng. Sau khi định danh thành công bằng Maldi-Tof, mẫu được gửi thực hiện PCR với primer đặc hiệu, kết quả giải trình tự khẳng định chủng Porphyromonas gingivalis cần tìm. Kết luận: Porphyromonas gingivalis có vai trò quan trọng trong sinh bệnh học của viêm nha chu. Nuôi cấy thành công Porphyromonas gingivalis tạo nguồn vi khuẩn có độc lực phục vụ cho các thử nghiệm với vi khuẩn nha chu. Từ khoá: Viêm nha chu, Porphyromonas gingivalis, nuôi cấy, định danh, Maldi-Tof ABSTRACT ISOLATION AND IDENTIFICATION OF PORPHYROMONAS GINGIVALIS FROM SUB-GINGIVAL PLAQUE SAMPLES OF PATIENTS WITH PERIODONTITIS Tran Thi Phuong Thao, Luong Thi My Ngan, Pham Anh Vu Thuy * Ho Chi Minh City Journal of Medicine * Vol. 22 - No 5- 2018: 178 – 183 Objective: To isolate and identify Porphyromonas gingivalis from subgingival plaques samples of patients with periodontitis Methods: Subgingival plaque samples were collected from patients with moderate to severe chronic periodontitis, and anaerobic culture was performed. Porphyromonas gingivalis were identified by using Maldi-Tof and confirmed by PCR. Results: Porphyromonas gingivalis was successfully isolated from sub-gingival plaque of 21th patient. It grew anaerobically on media containing lyses blood with dark pigmentation. These 1 - 2mm colonies were rounded, smooth and convex. After identifying by Maldi-Tof, quantitative PCR was performed using species- specific primers. Sequencing result confirmed the positive culture result. Conclusion: Porphyromonas gingivalis is one of the dominant pathogenic bacteria in periodontal pockets of *Khoa Răng Hàm Mặt, Đại học Y Dược TP. Hồ Chí Minh **Bộ môn Công nghệ sinh học thực vật và Chuyển hoá sinh học, Đại học Khoa học Tự nhiên, Đại học Quốc gia TP. Hồ Chí Minh. *** Bộ môn Nha chu, Khoa Răng Hàm Mặt, Đại học Y Dược TP. Hồ Chí Minh. Tác giả liên lạc: PGS. TS. Phạm Anh Vũ Thụy ĐT: 0916 810 874 Email: pavthuy@ump.edu.vn Y Học TP. Hồ Chí Minh * Tập 22 * Số 5 * 2018 Nghiên cứu Y học 179 patients with chronic periodontitis. Successful isolation of this organism provides virulent strain for periodontal research. Key words: Porphyromonas gingivalis, isolation, identify, Maldi-Tof. ĐẶT VẤN ĐỀ Porphyromonas gingivalis là một trong những yếu tố nguyên nhân chính trong sinh bệnh học và tiến triển tình trạng viêm của bệnh nha chu. Đây là vi khuẩn gram âm, không di động, không phân giải đường (asaccharolytic). Vi khuẩn kỵ khí này tạo ra một quần thể màu đen trên đĩa thạch máu và đòi hỏi bắt buộc phải có sắt để phát triển. Porphyromonas gingivalis được cho là sản xuất các yếu tố độc lực có thể xuyên qua nướu và gây phá huỷ mô trực tiếp hay gián tiếp, thông qua quá trình viêm. Các yếu tố độc lực của Porphyromonas gingivalis bao gồm nhung mao, hemagglutinin, vỏ nang, lipopolysaccharide, các túi màng ngoài, và các hoạt động enzyme hoá(1). Nếu việc phát hiện và định lượng vi khuẩn Porphyromonas gingivalis đã dần được thay thế bằng các phương pháp hiện đại như PCR - không đòi hỏi tế bào sống nhưng có khả năng nhận biết nhiều loại vi khuẩn bệnh nguyên khác nhau, thì nuôi cấy vi khuẩn vẫn giữ vai trò thiết yếu trong việc cung cấp nguồn vi khuẩn để thực hiện các nghiên cứu so sánh tỉ lệ vi khuẩn ở mẫu bệnh nhân viêm nha chu so với bệnh nhân khoẻ mạnh(13), các thử nghiệm về đặc điểm miễn dịch và tính chất enzyme(5), về phương pháp nuôi cấy(6) hay hoạt chất điều trị(14). Các nghiên cứu này đòi hỏi vi khuẩn sống và trao đổi chất, từ đó thể hiện đặc tính sinh học tương ứng với mục đích thử nghiệm, do đó, việc giữ vi khuẩn sinh trưởng và phát triển trong môi trường thích hợp là cần thiết. Porphyromonas gingivalis có vai trò quan trọng trong sinh bệnh học của viêm nha chu và vi khuẩn nuôi cấy trực tiếp từ bệnh nhân viêm nha chu cũng được cho có độc lực mạnh hơn và có giá trị trong các thử nghiệm in vitro so với chủng vi khuẩn sẵn có từ phòng thí nghiệm(15). Trong khi việc phân lập và định danh vi khuẩn này chưa được thực hiện thành công từ trước đến nay tại Việt Nam, do đó, mục tiêu của nghiên cứu này là phân lập vi khuẩn Porphyromonas gingivalis từ mảng bám dưới nướu của bệnh nhân viêm nha chu mạn mức độ từ trung bình tới nặng, sử dụng phương pháp Maldi-Tof để định danh, từ đó xác định quy trình và lưu trữ mẫu vi khuẩn cho các nghiên cứu liên quan trong tương lai. PHƯƠNG PHÁP - VẬT LIỆU NGHIÊN CỨU Đối tượng nghiên cứu Bệnh nhân viêm nha chu mạn mức độ từ trung bình tới nặng theo tiêu chuẩn phân loại của Hiệp hội nha chu Hoa Kỳ năm 2015(2) đến khám và điều trị tại Khoa Răng Hàm Mặt, Đại học Y Dược TP. Hồ Chí Minh. Các đối tượng không sử dụng thuốc kháng sinh, kháng viêm, thuốc tránh thai trước khi tham gia nghiên cứu 6 tháng và không có thói quen hút thuốc lá. Thu thập mẫu mảng bám cho tới khi nuôi cấy xuất hiện khuẩn lạc Porphyromonas gingivalis. Quy trình thực hiện Chuẩn bị môi trường vận chuyển và nuôi cấy: 2ml Wilkins Chalgren Anaerobic broth base (Hime – dia - M863) vào ống ly tâm eppendorf. Bổ sung 5% thạch máu cừu và đổ 15ml môi trường vào đĩa petri. Lấy mẫu Quy trình lấy mẫu được thực hiện theo phương pháp của Doan Nguyen và cs(6): giấy vô trùng đưa vào các túi nha chu từ 5mm trở lên, giữ trong 30s, và chuyển vào các ống eppendorf chứa môi trường vận chuyển, đưa vào túi chứa gói hút oxy và chuyển nhanh tới phòng thí nghiệm cấy mẫu. Nuôi cấy Vortex mẫu trong 45s, phần huyền phù vi khuẩn được pha loãng bậc 10 trong dung dịch vận chuyển, sử dụng que trải cấy dung dịch mẫu vào đĩa thạch. Sau khi ủ ở 37oC từ 7 - 10 ngày, Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 22 * Số 5 * 2018 180 khuẩn lạc có kiểu hình và màu sắc đặc trưng được cấy chuyền, làm thuần, định danh bằng phương pháp Maldi-Tof. Sau khi xác định chủng Porphyromonas gingivalis, mẫu khuẩn lạc được giữ trong dung dịch TE (Tris-EDTA) và gửi giải trình tự với đoạn mồi đặc hiệu bằng kỹ thuật PCR để khẳng định kết quả. Cuối cùng, chủng vi khuẩn được lưu trữ trong môi trường chứa glycerol ở điều kiện âm sâu. Hình 1. Quy trình nuôi cấy vi khuẩn Porphyromonas gingivalis Y Học TP. Hồ Chí Minh * Tập 22 * Số 5 * 2018 Nghiên cứu Y học 181 KẾT QUẢ Mẫu mảng bám sau khi ủ xuất hiện khuẩn lạc có nghi ngờ sự hiện diện vi khuẩn Porphyromonas gingivalis của bệnh nhân thứ 21. Khuẩn lạc có hình tròn, màu đen bóng, dạng lồi, tiêu huyết β, kích thước khoảng 1 - 2mm, kết quả nhuộm gram màu đỏ. Sau khi làm thuần, mẫu khuẩn lạc được gửi định danh bằng phương pháp Maldi-Tof. Kết quả hiển thị vi khuẩn Porphyromonas gingivalis cần tìm. Mẫu sau đó được gửi giải trình tự với PCR với đoạn mồi đặc hiệu. So sánh kết quả với ngân hàng gen khẳng định chủng Porphyromonas gingivalis. Hình 2. Hệ vi khuẩn nuôi cấy từ mẫu mảng bám sau 10 ngày Hình 3. Khuẩn lạc màu đen, tròn láng, thể lồi trên đĩa thạch máu sau khi làm thuần AAAAGTACTCTTCGGCTCTATGTAGGTGCTGCATGG TTGTCGTCAGCTCGTGCCGTGAGGTGTCGGCTTAAG TGCCATAACGAGCGCAACCCACATCGGTAGTTGCTA ACAGTTTTCGCTGAGGACTCTACCGAGACTGCCGTC GTAAGGCGTGAGGAAGGTGGGGATGACGTACCC (177) Hình 4. Kết quả định danh vi khuẩn Porphyromonas gingivalis bằng phương pháp Maldi-Tof. Hình 5. Kết quả giải trình tự bằng phương pháp PCR. Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 22 * Số 5 * 2018 182 BÀN LUẬN Viêm nha chu là bẹ ̂nh lý viêm mạn tính, đa yếu tố dẫn tới sự phá huỷ mô nâng đỡ ra ̆ng và là nguyên nhân chính của hiẹ ̂n tượng mất ra ̆ng. Các tổn thương viêm nha chu được chứng minh liên quan tới hẹ ̂ vi khuẩn dưới nướu, chứa chủ yếu các loài vi khuẩn gram âm, trong đó vi khuẩn màu đen Porphyromonas gingivalis được cho là bẹ ̂nh nguyên chính(8). Để phân tích các vi khuẩn trong các túi nha chu đặc hiẹ ̂u, mảng bám dưới nướu hoặc mẫu dịch nướu là phù hợp nhất(16). Một trong những cách thu thập mảng bám dưới nướu là dung một côn giấy vô khuẩn đưa vào túi nha chu. Nhiều nghiên cứu sử dụng các dung dịch vận chuyển và nuôi cấy mẫu khác nhau. Do tính chất cần sắt để phát triển, môi trường nuôi cấy cần có hemin và menadione để hỗ trợ viẹ ̂c phân lập Porphyromonas gingivalis. Nuôi cấy không chọn lọc được cho là phương pháp hiẹ ̂u quả nhất để bộc lộ tất cả các thành phần bẹ ̂nh nguyên chính của hẹ ̂ vi khuẩn nha chu, nhằm nhận biết sự hiẹ ̂n diẹ ̂n của các bẹ ̂nh nguyên nha chu ít gặp, và xác định độ nhạy kháng khuẩn của các bẹ ̂nh nguyên này. Do Porphyromonas gingivalis là một vi khuẩn kỵ khí bắt buộc, nên quá trình nuôi cấy phân lập loại vi khuẩn này đòi hỏi tiêu chuẩn khắt khe trong viẹ ̂c duy trì môi trường không có oxy. Hẹ ̂ thống bình chứa cùng túi tạo môi trường kỵ khí là phương pháp nuôi cấy kỵ khí phổ biến nhất trong các phòng thí nghiẹ ̂m lâm sàng(6). So với các vi khuẩn hiếu khí, các vi khuẩn kỵ khí bắt buộc như Porphyromonas gingivalis đòi hỏi thời gian nuôi cấy dài, và môi trường nuôi cấy không có oxy ở nhiẹ ̂t độ tối ưu (35 - 37oC). Các chủng vi khuẩn có sẵn từ phòng thí nghiẹ ̂m rút ngắn thời gian nuôi cấy, thay đổi từ 2 - 4 ngày, nhưng đối với các mẫu mảng bám/dịch nướu, thời gian để nuôi cấy vi khuẩn Porphyromonas gingivalis thay đổi từ 5 - 7 ngày(6), 14 ngày(3) cho tới 3 tuần(13). Nghiên cứu của chúng tôi cần thời gian từ 7 - 10 ngày để quan sát sự xuất hiẹ ̂n của Porphyromonas gingivalis trên môi trường thạch máu. Khả năng xâm chiếm và tăng sinh của bệnh nguyên trong một môi trường vật chủ đặc biệt là điều kiện tiên quyết cho quá trình nhiễm khuẩn. Sự phát triển này phụ thuộc vào việc lấy được những dưỡng chất thiết yếu, mà trong đó, sắt đóng vai trò quan trọng cho sự hình thành và tiến triển của nhiễm khuẩn. Ở vật chủ là người, phần lớn sắt có trong tế bào, và ở dưới dạng hemoglobin, protein hemin hay ferritin. Một lượng nhỏ sắt ngoại bào thường kết hợp với các protein vận chuyển như transferrin trong huyết thanh và lactoferrin trên bề mặt niêm mạc. Do sự phong phú của chất này trong cơ thể vật chủ, các hoạt chất chứa heme là một nguồn sắt quan trọng cho quá trình xâm nhiễm của vi sinh vật. Các bệnh nguyên sống nội bào có thể sử dụng heme trực tiếp. Tuy nhiên, đối với các vi khuẩn bệnh nguyên ngoại bào, heme phải được giải phóng khỏi tế bào, điều này gây ra các dạng tổn thương mô điển hình khi có hoạt động giải phóng vật liệu nội bào xảy ra. Heme và hemoglonin bị ràng buộc bởi protein huyết tương, haptoglobin và hemopexin. Các vi sinh vật phải thực hiện cơ chế để loại bỏ phần tử heme hoặc sắt vô cơ ra các protein gắn sắt của vật chủ. Khả năng sử dụng hemin và các hợp chất chứa hemin để tạo ra dưỡng chất sắt đã được ghi nhận ở nhiều vi khuẩn gây bệnh, bao gồm Porphyromonas gingivalis(10).Theo Gibbons và cs(7), sự phát triển của vi khuẩn tỉ lệ với nồng độ hemin từ 0,05 tới 1,0 ug/ml môi trường, đồng thời họ cũng khẳng định vai trò của vitamin K hay menadion trong việc hỗ trợ sự sinh trưởng của các chủng vi khuẩn kị khí. Đó là lý do vì sao hemin và menadion có mặt hầu hết trong các loại môi trường nuôi cấy Porphyromonas gingivalis. Trong nghiên cứu này, chúng tôi sử dụng môi trường Wilkins Chalgren Anaerobic Broth Base, ngoài việc là môi trường giàu dinh dưỡng với các thành phần như cao nấm men, peptone, L-arginine, casein và các muối, hemin và menadione cũng được bổ sung với nồng độ Y Học TP. Hồ Chí Minh * Tập 22 * Số 5 * 2018 Nghiên cứu Y học 183 lần lượt là 0,005 và 0,0005g/l. Do thiếu superoxide dismutase và catalase, Porphyromonas gingivalis bắt buộc không có mặt oxy để phát triển, do đó, sử dụng các hệ thống kỵ khí, như GasPak đã đề xuất nhằm hỗ trợ việc sinh trưởng của các vi khuẩn này(6). Trong nghiên cứu này, chúng tôi sử dụng bình GasPak (Merk) và túi tạo môi trường kỵ khí AnaeroPack (Mitsubishi Gas Chemical Co-Japan) và ủ ở nhiệt độ 37oC. Tuy nhiên, đến mẫu bệnh nhân thứ 21, khuẩn lạc Porphyromonas gingivalis mới xuất hiện. Điều này liên quan tới tỉ lệ Porphyromonas gingivalis có trong mẫu mảng bám dưới nướu và khả năng sinh trưởng trong môi trường nuôi cấy(9). Để xác định vi khuẩn Porphyromonas gingivalis, bên cạnh việc dựa trên hình dáng và màu sắc đặc trưng của quần thể, người ta tiến hành nhuộm gram, phân tích sinh hoá, và sử dụng các phương pháp hiện đại hơn như PCR, Maldi-Tof. Phương pháp sinh hoá đòi hỏi các thử nghiệm trên môi trường nuôi cấy lỏng, do đó đối với một số vi khuẩn có khả năng sinh trưởng thấp như Porphyromonas gingivalis có thể cho kết quả không chính xác. Bên cạnh đó, thời gian ủ kéo dài để có thể đọc được kết quả cũng là một bất lợi của phương pháp này(12). Maldi (Matrix- assisted laser desorption ionization) là phương pháp ion hóa mẫu hấp thụ dựa trên sự hỗ trợ của các chất nền và năng lượng laser. Nguồn Maldi sử dụng các chất nền hỗ trợ để ion hóa mẫu dưới tác dụng của năng lượng laser lớn. Mẫu xét nghiệm được tinh sạch bằng nhiều phương pháp, sau đó trộn với chất nền chứa các phân tử hữu cơ nhỏ có khả năng hấp thụ năng lượng ánh sáng ở những bước sóng nhất định, ở đây có thể là axit yếu như sinapinic. Chuyển hỗn hợp này lên khay và làm bay hơi, tạo ra các hạt tinh thể bám với peptid. Nhờ nguồn laser năng lượng cực lớn chiếu vào, các chất nền sẽ hấp thu năng lượng và bật ra các ion. Các ion có thể tích điện dương hay âm tuỳ vào bản chất. Các protein và peptid tích điện dương trong khi các oligonucleotid và saccaride tích điện âm. Thời gian bay của ion (Time of flight) được đo và chuyển đổi thông tin dưới dạng phổ. Công nghệ khối phổ giúp định danh vi khuẩn chính xác và thời gian đưa ra kết quả nhanh, bảo quản kết quả và chia sẻ thông tin kỹ thuật số dễ dàng hơn. Đối với Porphyromonas gingivalis, theo tác giả Rams và cs(11), việc định danh nhanh chóng kiểu hình của vi khuẩn này trong mẫu mảng bám dưới nướu chính xác 100% với kỹ thuật Maldi-Tof. Sở dĩ chúng tôi lựa chọn Maldi-Tof là phương pháp định danh vi khuẩn nuôi cấy vì đây là phương pháp dựa trên proteomic nhanh, tin cậy và có giá thành hợp lý. Trong bài tổng quan của tác giả Clark và cs(4), phương pháp Maldi-Tof có tầm quan trọng đặc biệt đối với việc xác định thông thường các mầm bệnh cần thời gian ủ lâu dài để phân lập và không hoạt hóa sinh học như các vi khuẩn kỵ khí và khẳng định rằng, thông qua việc sử dụng Maldi-Tof MS, các chủng Porphyromonas có thể được phân biệt. Không những thế, bên cạnh độ chính xác lên tới 97% cho 227 chủng và 9 loài Bacteroides, 84 dòng vi khuẩn kỵ khí trong khoang miệng cũng được phân tích trong một nghiên cứu được thiết kế để tinh giản việc xác định các vi khuẩn từ bệnh nhân mắc bệnh lý nha chu. Công nghệ này có thể phân biệt giữa hai loài Prevotella là Prevotella intermedia và Prevotella nigrescens, một công việc tốn kém và tốn thời gian khi phân tích gen16S rRNA. Tuy nhiên, qua các kết quả thu được, các tác giả đã kết luận rằng việc mở rộng và tối ưu hoá cơ sở dữ liệu là cần thiết. Trong nghiên cứu này, chúng tôi gửi mẫu vi khuẩn phân tích với hệ thống Bruker BioTyper và nhận các giá trị log là 1,954; 2,139; 2,17 và 2,154. Theo hướng dẫn của hệ thống, giá trị log (điểm) ≥ 2,00 có thể được coi là một xác suất tốt để nhận dạng vi khuẩn thử nghiệm ở cấp độ loài. KẾT LUẬN Porphyromonas gingivalis là vi khuẩn có vai trò quan trọng trong sinh bẹ ̂nh học của bẹ ̂nh lý nha chu và tồn tại trong nhiều bẹ ̂nh lý toàn thân khác. Nuôi cấy thành công vi khuẩn Porphyromonas gingivalis từ mảng bám dưới Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Tập 22 * Số 5 * 2018 184 nướu của bẹ ̂nh nhân viêm nha chu trong nghiên cứu này là phương pháp không xâm lấn, kết hợp với sự hỗ trợ định danh bằng Maldi-Tof tạo nguồn vi khuẩn có độc lực phục vụ cho các thí nghiẹ ̂m nghiên cứu khác nhau trong tương lai tại Việt Nam. TÀI LIỆU THAM KHẢO 1. Africa C (2012), “The Microbial Aetiology of Periodontal Diseases” in Periodontal Diseases — A Clinician’s Guide, J. Manakil, Ed., chapter 1, InTech. 2. American Academy of Periodontology (2015), “American Academy of Periodontology Task Force Report on the Update to the 1999 Classification of Periodontal Diseases and Conditions”. Journal of Periodontology; 86(7): 835-838. 3. Boutaga K, van Winkelhoff AJ, Vandenbroucke-Grauls CMJE, Savelkoul PHM (2003), “Comparison of Real- Time PCR and Culture for Detection of Porphyromonas gingivalis in Subgingival Plaque Samples”. Journal of Clinical Microbiology; 41(11): 4950– 4954.. 4. Clark AE, Kaleta EJ, Arora A, Wolk DM (2013), “Matrix- Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry: a Fundamental Shift in the Routine Practice of Clinical Microbiology”. Clinical Microbiology Reviews; 26(3): 547– 603. 5. Darveau RP, Belton CM, Reife RA, Lamont RJ (1998), “Local Chemokine Paralysis, a Novel Pathogenic Mecha- nism for Porphyromonas gingivalis". Infection and Immunity; 66(4): 1660– 1665. 6. Doan N, Contreras A, Flynn J, Morrison J, Slots J (1999), “Proficiencies of three anaerobic culture systems for recovering periodontal pathogenic bacteria”. Journal of Clinical Microbiology; 37: 171-174. 7. Gibbons RJ, Macdonald JB (1960), “Hemin and vitamin K compounds as required factors for the cultivation of certain strains of Bacteroides melaninogenicus”. Journal of Bacteriology; 80(2):164–170. 8. Hajishengallis G, Darveau RP, Curtis MA (2012), “The keystone- pathogen hypothesis”. Nature Reviews Microbi- ology; 10: 717– 725. 9. Hajishengallis G, Liang S, Payne MA, Hashim A, Jotwani R, Eskan MA et al (2011), “Low-abundance biofilm species orchestrates inflammatory periodontal disease through the commensal microbiota and complement”. Cell Host Microbe; 10: 497– 506. 10. Otto BR, Verweij-van Vught AMJJ, MacLaren DM (1992), “Transferrins and heme-compounds as iron sources for pathogenic bacteria”. Boca Raton (FL): CRC Press; 217- 233. 11. Rams TE, Sautter JD, Getreu A, van Winkelhoff AJ (2016), “Phenotypic identification of Porphyromonas gingi- valis validated with matrix-assisted laser desorption/ionization time- of-flight mass spectrometry”. Microbial Pathogenesis; 94: 112-116. 12. Slots, J, and HS Reynolds (1982), “Long-wave UV light fluorescence for identification of black-pigmented Bac- teroides spp”. Journal of Clinical Microbiology; 16: 1148-1151. 13. Van Winkelhoff AJ, Loos BG, Van der Reijden WA, Van der Velden U (2002), “Porphyromonas gingivalis, Bacteroides forsythus and other putative periodontal pathogens in subjects with and without periodontal destruction”. Journal of Clinical Periodontology; 29: 1023–1028. 14. Wright TL, Ellen RP, Lacroix JM et al (1997). Effects of metronidazole on Porphyromonas gingivalis biofilms. Journal of Periodontal Research; 32: 473–477. 15. Yang LC, Hu SW, Yan M, Yang JJ, Tsou SH, Lin YY (2015), “Antimicrobial activity of platelet-rich plasma and other plasma preparations against periodontal pathogens”. Journal of Periodontology; 86: 310–318. 16. Yoshida A, Ansai T (2012), “Microbiological diagnosis for periodontal disease” in Periodontal Diseases—A Clinician’s Guide, J. Manakil, Ed., chapter 2, InTech. Ngày nhận bài báo: 10/06/2018 Ngày phản biện nhận xét bài báo: 20/06/2018 Ngày bài báo được đăng: 20/09/2018

Các file đính kèm theo tài liệu này:

  • pdfnuoi_cay_va_dinh_danh_vi_khuan_porphyromonas_gingivalis_tu_m.pdf
Tài liệu liên quan