Bài giảng Biology - Chapter 20: DNA Technology and Genomics

Tài liệu Bài giảng Biology - Chapter 20: DNA Technology and Genomics: Chapter 20DNA Technology and GenomicsOverview: Understanding and Manipulating GenomesOne of the greatest achievements of modern scienceHas been the sequencing of the human genome, which was largely completed by 2003DNA sequencing accomplishmentsHave all depended on advances in DNA technology, starting with the invention of methods for making recombinant DNADNA technology has launched a revolution in the area of biotechnologyThe manipulation of organisms or their genetic components to make useful productsAn example of DNA technology is the microarrayA measurement of gene expression of thousands of different genesFigure 20.1Concept 20.1: DNA cloning permits production of multiple copies of a specific gene or other DNA segmentTo work directly with specific genesScientists have developed methods for preparing well-defined, gene-sized pieces of DNA in multiple identical copies, a process called gene cloningDNA Cloning and Its Applications: A PreviewMost methods for cloning pieces of DNA i...

ppt66 trang | Chia sẻ: honghanh66 | Lượt xem: 1061 | Lượt tải: 0Freedownload
Bạn đang xem trước 20 trang mẫu tài liệu Bài giảng Biology - Chapter 20: DNA Technology and Genomics, để tải tài liệu gốc về máy bạn click vào nút DOWNLOAD ở trên
Chapter 20DNA Technology and GenomicsOverview: Understanding and Manipulating GenomesOne of the greatest achievements of modern scienceHas been the sequencing of the human genome, which was largely completed by 2003DNA sequencing accomplishmentsHave all depended on advances in DNA technology, starting with the invention of methods for making recombinant DNADNA technology has launched a revolution in the area of biotechnologyThe manipulation of organisms or their genetic components to make useful productsAn example of DNA technology is the microarrayA measurement of gene expression of thousands of different genesFigure 20.1Concept 20.1: DNA cloning permits production of multiple copies of a specific gene or other DNA segmentTo work directly with specific genesScientists have developed methods for preparing well-defined, gene-sized pieces of DNA in multiple identical copies, a process called gene cloningDNA Cloning and Its Applications: A PreviewMost methods for cloning pieces of DNA in the laboratoryShare certain general features, such as the use of bacteria and their plasmidsOverview of gene cloning with a bacterial plasmid, showing various uses of cloned genesFigure 20.2BacteriumBacterial chromosomePlasmidCell containing gene of interestRecombinant DNA (plasmid)Gene of interestDNA of chromosomeRecombinate bacteriumProtein harvestedBasic research on proteinGene of interestCopies of geneBasic research on geneGene for pest resistance inserted into plantsGene used to alter bacteria for cleaning up toxic wasteProtein dissolves blood clots in heart attack therapyHuman growth hormone treats stunted growthProtein expressed by gene of interest3Gene inserted into plasmid1Plasmid put into bacterial cell2Host cell grown in culture, to form a clone of cells containing the “cloned” gene of interest3Basic research and various applications4Using Restriction Enzymes to Make Recombinant DNABacterial restriction enzymesCut DNA molecules at a limited number of specific DNA sequences, called restriction sitesA restriction enzyme will usually make many cuts in a DNA moleculeYielding a set of restriction fragmentsThe most useful restriction enzymes cut DNA in a staggered way Producing fragments with “sticky ends” that can bond with complementary “sticky ends” of other fragmentsDNA ligase is an enzymeThat seals the bonds between restriction fragments Figure 20.3Restriction siteDNA5353G A A T T CC T T A A GSticky endFragment from different DNA molecule cut by the same restriction enzymeOne possible combinationRecombinant DNA moleculeGC T T A AA A T T CGA A T T CC T T A AGGGGA A T T CA A T T CCT T A AGC T T A AGUsing a restriction enzyme and DNA ligase to make recombinant DNARestriction enzyme cuts the sugar-phosphate backbones at each arrow1DNA fragment from another source is added. Base pairing of sticky ends produces various combinations.2DNA ligase seals the strands.3Cloning a Eukraryotic Gene in a Bacterial PlasmidIn gene cloning, the original plasmid is called a cloning vectorDefined as a DNA molecule that can carry foreign DNA into a cell and replicate thereProducing Clones of Cells1Isolate plasmid DNA and human DNA.2Cut both DNA samples with the same restriction enzyme3Mix the DNAs; they join by base pairing. The products are recombinant plasmids andmany nonrecombinant plasmids.APPLICATIONCloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research.TECHNIQUEIn this example, a human gene is inserted into a plasmid from E. coli. The plasmid contains the ampR gene, which makes E. coli cells resistant to the antibiotic ampicillin. It also contains the lacZ gene, which encodes -galactosidase. This enzyme hydrolyzes a molecular mimic of lactose (X-gal) to form a blue product. Only three plasmids and three human DNA fragments are shown, but millions of copies of the plasmid and a mixture of millions of different human DNA fragments would be present in the samples.Sticky endsHuman DNA fragmentsHuman cellGene of interestBacterial cellampR gene(ampicillinresistance)Bacterial plasmidRestriction siteRecombinant DNA plasmidslacZ gene (lactose breakdown)Figure 20.4RESULTSOnly a cell that took up a plasmid, which has the ampR gene, will reproduce and form a colony. Colonies with nonrecombinant plasmids will be blue, because they can hydrolyze X-gal. Colonies with recombinant plasmids, in which lacZ is disrupted, will be white, because they cannot hydrolyze X-gal. By screening the white colonies with a nucleic acid probe (see Figure 20.5), researchers can identify clones of bacterial cells carrying the gene of interest.Colony carrying non- recombinant plasmid with intact lacZ geneBacterial cloneColony carrying recombinant plasmid with disrupted lacZ geneRecombinant bacteria4Introduce the DNA into bacterial cells that have a mutation in their own lacZ gene.5Plate the bacteria on agar containingampicillin and X-gal. Incubate untilcolonies grow.Identifying Clones Carrying a Gene of InterestA clone carrying the gene of interestCan be identified with a radioactively labeled nucleic acid probe that has a sequence complementary to the gene, a process called nucleic acid hybridizationAPPLICATIONHybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest.TECHNIQUECells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate.RESULTSColonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes.Colonies containing gene of interestFilterMaster plateSolution containing probeFilter lifted and flipped overRadioactive single-stranded DNAHybridization on filterSingle-stranded DNA from cellProbe DNA Gene of interestFilmMaster plateFigure 20.5Nucleic acid probe hybridizationA special filter paper is pressed against the master plate, transferring cells to the bottom side of the filter.1The filter is treated to break open the cells and denature their DNA; the resulting single- stranded DNA molecules are treated so that they stick to the filter. 2The filter is laid under photographic film, allowing any radioactive areas to expose the film (autoradiography). 3After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest.4Storing Cloned Genes in DNA LibrariesA genomic library made using bacteriaIs the collection of recombinant vector clones produced by cloning DNA fragments derived from an entire genomeFigure 20.6Foreign genomecut up withrestrictionenzymeRecombinant plasmidsRecombinant phage DNAPhage clones(b) Phage library(a) Plasmid libraryorBacterial clonesA genomic library made using bacteriophagesIs stored as a collection of phage clonesA complementary DNA (cDNA) libraryIs made by cloning DNA made in vitro by reverse transcription of all the mRNA produced by a particular cellCloning and Expressing Eukaryotic GenesAs an alternative to screening a DNA library for a particular nucleotide sequenceThe clones can sometimes be screened for a desired gene based on detection of its encoded proteinBacterial Expression SystemsSeveral technical difficultiesHinder the expression of cloned eukaryotic genes in bacterial host cellsTo overcome differences in promoters and other DNA control sequencesScientists usually employ an expression vector, a cloning vector that contains a highly active prokaryotic promoterEukaryotic Cloning and Expression SystemsThe use of cultured eukaryotic cells as host cells and yeast artificial chromosomes (YACs) as vectorsHelps avoid gene expression problemsAmplifying DNA in Vitro: The Polymerase Chain Reaction (PCR)The polymerase chain reaction, PCRCan produce many copies of a specific target segment of DNAUses primers that bracket the desired sequenceUses a heat-resistant DNA polymeraseThe PCR procedureFigure 20.7Targetsequence535Genomic DNACycle 1yields2 moleculesCycle 2yields4 moleculesCycle 3yields 8 molecules;2 molecules(in white boxes)match targetsequence5335PrimersNew nucleo- tides3APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro.TECHNIQUE The starting materials for PCR are double-stranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence.RESULTS During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length (see white boxes above). After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more.Denaturation:Heat brieflyto separate DNA strands1Annealing: Cool to allow primers to hydrogen-bond.2Extension:DNA polymeraseadds nucleotides to the 3 end of each primer3Concept 20.2: Restriction fragment analysis detects DNA differences that affect restriction sitesRestriction fragment analysisCan rapidly provide useful comparative information about DNA sequencesGel Electrophoresis and Southern BlottingGel electrophoresis Separates DNA restriction fragments of different lengthsFigure 20.8APPLICATION1Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end.2When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. CathodePowersourceGelGlass platesAnodeMixtureof DNAmoleculesof differ-ent sizesLonger moleculesShorter moleculesTECHNIQUERESULTSAfter the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources.Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10).Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length.Restriction fragment analysisIs useful for comparing two different DNA molecules, such as two alleles for a geneFigure 20.9a, bNormal  -globin alleleSickle-cell mutant -globin allele175 bp201 bpLarge fragmentDdeIDdeIDdeIDdeIDdeIDdeIDdeI376 bpLarge fragmentDdeI restriction sites in normal and sickle-cell alleles of -globin gene.Electrophoresis of restriction fragments from normal and sickle-cell alleles.Normal alleleSickle-cell alleleLarge fragment201 bp 175 bp376 bp(a)(b)Specific DNA fragments can be identified by Southern blottingUsing labeled probes that hybridize to the DNA immobilized on a “blot” of the gel Southern blotting of DNA fragmentsAPPLICATIONResearchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA.TECHNIQUEIn this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III).DNA + restriction enzymeRestrictionfragmentsIIIIIII Normal-globinalleleII Sickle-cellalleleIII HeterozygotePreparation of restriction fragments.Gel electrophoresis.Blotting.GelSpongeAlkaline solutionNitrocellulosepaper (blot)Heavy weightPaper towels123Figure 20.10RESULTSBecause the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20.9b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II).Radioactivelylabeled probefor -globingene is addedto solution ina plastic bagProbe hydrogen-bonds to fragmentscontaining normalor mutant -globinFragment fromsickle-cell-globin alleleFragment fromnormal -globinallelePaper blotFilm overpaper blotHybridization with radioactive probe.Autoradiography.IIIIIIIIIIII12Restriction Fragment Length Differences as Genetic MarkersRestriction fragment length polymorphisms (RFLPs)Are differences in DNA sequences on homologous chromosomes that result in restriction fragments of different lengthsSpecific fragmentsCan be detected and analyzed by Southern blottingThe thousands of RFLPs present throughout eukaryotic DNACan serve as genetic markersConcept 20.3: Entire genomes can be mapped at the DNA levelThe Human Genome ProjectSequenced the human genomeScientists have also sequenced genomes of other organismsProviding important insights of general biological significanceGenetic (Linkage) Mapping: Relative Ordering of MarkersThe initial stage in mapping a large genomeIs to construct a linkage map of several thousand genetic markers spaced throughout each of the chromosomesCytogenetic mapChromosome bandingpattern and location ofspecific genes byfluorescence in situhybridization (FISH)Genetic (linkage)mapping Ordering of genetic markers such as RFLPs, simple sequence DNA, and other polymorphisms (about 200 per chromosome)Physical mappingOrdering of large over-lapping fragmentscloned in YAC and BACvectors, followed byordering of smallerfragments cloned inphage and plasmidvectorsDNA sequencingDetermination ofnucleotide sequence ofeach small fragment andassembly of the partialsequences into the com-plete genome sequenceChromosomebandsGenes locatedby FISHGeneticmarkersOverlapping fragmentsGACTTCATCGGTATCGAACT123Figure 20.113The order of the markers and the relative distances between them on such a mapAre based on recombination frequenciesPhysical Mapping: Ordering DNA FragmentsA physical mapIs constructed by cutting a DNA molecule into many short fragments and arranging them in order by identifying overlapsGives the actual distance in base pairs between markersDNA SequencingRelatively short DNA fragmentsCan be sequenced by the dideoxy chain-termination methodDideoxy chain-termination method for sequencing DNAFigure 20.12DNA(template strand)PrimerDeoxyribonucleotidesDideoxyribonucleotides(fluorescently tagged)TGTT35DNA polymeraseCTGACTTCGACAAPPPPPPdATPdCTPdTTPdGTPGOHddATPddCTPddTTPddGTPGH5353CTGACTTCGACAAddCTGTTddGCTGTTddAGCTGTTddAAGCTGTTddGAAGCTGTTddTGAAGCTGTTddCTGAAGCTGTTddACTGAAGCTGTTddGACTGAAGCTGTT3DNA (template strand)Labeled strandsDirectionof movementof strandsLaserDetectorAPPLICATIONThe sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length.TECHNIQUEThis method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (ddNTP), a modified nucleotide. Incorporation of a ddNTP terminates a growing DNA strand because it lacks a 3’—OH group, the site for attachment of the next nucleotide (see Figure 16.12). In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary ddNT. Because each type of ddNTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined.RESULTSThe color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer.)GACTGAAGCLinkage mapping, physical mapping, and DNA sequencing Represent the overarching strategy of the Human Genome ProjectAn alternative approach to sequencing whole genomes starts with the sequencing of random DNA fragmentsPowerful computer programs would then assemble the resulting very large number of overlapping short sequences into a single continuous sequence1234Cut the DNA frommany copies of anentire chromosomeinto overlapping frag-ments short enoughfor sequencing.Clone the fragmentsin plasmid or phagevectorsSequence eachfragment Order thesequences into oneoverall sequencewith computersoftware.ACGATACTGGTCGCCATCAGTACGATACTGGTAGTCCGCTATACGAATCGCCATCAGTCCGCTATACGATACTGGTCAAFigure 20.13Concept 20.4: Genome sequences provide clues to important biological questionsIn genomicsScientists study whole sets of genes and their interactionsIdentifying Protein-Coding Genes in DNA SequencesComputer analysis of genome sequencesHelps researchers identify sequences that are likely to encode proteinsCurrent estimates are that the human genome contains about 25,000 genesBut the number of human proteins is much largerTable 20.1Comparison of the sequences of “new” genesWith those of known genes in other species may help identify new genesDetermining Gene FunctionFor a gene of unknown functionExperimental inactivation of the gene and observation of the resulting phenotypic effects can provide clues to its functionStudying Expression of Interacting Groups of GenesDNA microarray assays allow researchers to compare patterns of gene expression In different tissues, at different times, or under different conditionsDNA microarray assay of gene expression levelsAPPLICATIONTECHNIQUETissue samplemRNA moleculesLabeled cDNA molecules(single strands)DNAmicroarraySize of an actualDNA microarraywith all the genesof yeast (6,400spots)Isolate mRNA.1 With this method, researchers can test thousands of genes simultaneously to determine which ones are expressed in a particular tissue, under different environmental conditions in various disease states, or at different developmental stages. They can also look for coordinated gene expression.Make cDNA by reverse transcription, using fluores-cently labeled nucleotides.2Apply the cDNA mixture to a microarray, a microscope slide on which copies of single-stranded DNA fragments from the organism‘s genes are fixed, a different gene in each spot. The cDNA hybridizes with any complementary DNA on the microarray. 3Rinse off excess cDNA; scan microarray for fluorescence. Each fluorescent spot (yellow) represents a gene expressed in the tissue sample.4RESULT The intensity of fluorescence at each spot is a measure of the expression of the gene represented by that spot in the tissue sample. Commonly, two different samples are tested together by labeling the cDNAs prepared from each sample with a differently colored fluorescence label. The resulting color at a spot reveals the relative levels of expression of a particular gene in the two samples, which may be from different tissues or the same tissue under different conditions.Figure 20.14Comparing Genomes of Different SpeciesComparative studies of genomes from related and widely divergent speciesAre providing valuable information in many fields of biologyFuture Directions in GenomicsGenomicsIs the study of entire genomesProteomicsIs the systematic study of all the proteins encoded by a genomeSingle nucleotide polymorphisms (SNPs)Provide useful markers for studying human genetic variationConcept 20.5: The practical applications of DNA technology affect our lives in many waysNumerous fields are benefiting from DNA technology and genetic engineeringMedical ApplicationsOne obvious benefit of DNA technologyIs the identification of human genes whose mutation plays a role in genetic diseasesDiagnosis of DiseasesMedical scientists can now diagnose hundreds of human genetic disordersBy using PCR and primers corresponding to cloned disease genes, then sequencing the amplified product to look for the disease-causing mutationEven when a disease gene has not yet been clonedThe presence of an abnormal allele can be diagnosed with reasonable accuracy if a closely linked RFLP marker has been foundFigure 20.15RFLP markerDNARestrictionsitesDisease-causingalleleNormal alleleHuman Gene TherapyGene therapyIs the alteration of an afflicted individual’s genesHolds great potential for treating disorders traceable to a single defective geneUses various vectors for delivery of genes into cellsFigure 20.16Bonemarrowcell frompatientRetroviruscapsidViral RNACloned gene (normal allele, absent from patient’s cells)2Gene therapy using a retroviral vectorInsert RNA version of normal allele into retrovirus.1Let retrovirus infect bone marrow cellsthat have been removed from thepatient and cultured.2Viral DNA carrying the normalallele inserts into chromosome.3Inject engineeredcells into patient.4Pharmaceutical ProductsApplications of DNA technology includeLarge-scale production of human hormones and other proteins with therapeutic usesProduction of safer vaccinesForensic EvidenceDNA “fingerprints” obtained by analysis of tissue or body fluids found at crime scenesCan provide definitive evidence that a suspect is guilty or notA DNA fingerprintIs a specific pattern of bands of RFLP markers on a gelDefendant’sblood (D)Blood fromdefendant’sclothesVictim’sblood (V)DJeansshirtV4 g8 gFigure 20.17DNA fingerprintingCan also be used in establishing paternityEnvironmental CleanupGenetic engineering can be used to modify the metabolism of microorganismsSo that they can be used to extract minerals from the environment or degrade various types of potentially toxic waste materialsAgricultural ApplicationsDNA technologyIs being used to improve agricultural productivity and food qualityAnimal Husbandry and “Pharm” AnimalsTransgenic animalsContain genes from other organismsHave been engineered to be pharmaceutical “factories”Figure 20.18Genetic Engineering in PlantsAgricultural scientistsHave already endowed a number of crop plants with genes for desirable traitsThe Ti plasmidIs the most commonly used vector for introducing new genes into plant cellsAPPLICATIONGenes conferring useful traits, such as pest resistance, herbicide resistance, delayed ripening, and increased nutritional value, can be transferred from one plant variety or species to another using the Ti plasmid as a vector.TECHNIQUETransformed cells carrying the transgene of interest can regenerate complete plants that exhibit the new trait conferred by the transgene.RESULTS1The Ti plasmid is isolated from the bacterium Agrobacteriumtumefaciens. The segment of the plasmid that integrates intothe genome of host cells is called T DNA. 2Isolated plasmids and foreign DNA containing a gene ofinterest are incubated with a restriction enzyme that cuts inthe middle of T DNA. After base pairing occurs betweenthe sticky ends of the plasmids and foreign DNAfragments, DNA ligase is added. Some of the resultingstable recombinant plasmids contain the gene of interest.3Recombinant plasmids can be introduced into cultured plantcells by electroporation. Or plasmids can be returned toAgrobacterium, which is then applied as a liquid suspensionto the leaves of susceptible plants, infecting them. Once aplasmid is taken into a plant cell, its T DNA integrates intothe cell‘s chromosomal DNA.Agrobacterium tumefaciensTi plasmidSite whererestrictionenzyme cutsT DNADNA withthe geneof interestRecombinantTi plasmidPlant withnew traitFigure 20.19Safety and Ethical Questions Raised by DNA TechnologyThe potential benefits of genetic engineeringMust be carefully weighed against the potential hazards of creating products or developing procedures that are harmful to humans or the environmentToday, most public concern about possible hazardsCenters on genetically modified (GM) organisms used as food

Các file đính kèm theo tài liệu này:

  • pptchapter20_5684.ppt
Tài liệu liên quan