Tài liệu Bài giảng Biology - Chapter 18: Genomics: GenomicsChapter 181Mapping GenomesMaps of genomes can be divided into 2 types -Genetic maps -Abstract maps that place the relative location of genes on chromosomes based on recombination frequency -Physical maps -Use landmarks within DNA sequences, ranging from restriction sites to the actual DNA sequence2Physical MapsDistances between “landmarks” are measured in base-pairs -1000 basepairs (bp) = 1 kilobase (kb)Knowledge of DNA sequence is not necessaryThere are three main types of physical maps -Restriction maps -Cytological maps -Radiation hybrid maps3Physical MapsRestriction maps -The first physical maps -Based on distances between restriction sites -Overlap between smaller segments can be used to assemble them into a contig -Continuous segment of the genome4MolecularweightmarkerAAAABBB14 kb5 kbAA8 kb9 kb2 kb9 kb5 kb3 kb2 kb2 kb2 kb2 kb2 kb3 kb6 kb5 kb5 kb5 kb10 kb10 kb19 kb9 kb9 kb8 kb14 kb14 kb1. Multiple copies of a segment of DNA are cut with restriction enzymes.2. The fra...
51 trang |
Chia sẻ: honghanh66 | Lượt xem: 1233 | Lượt tải: 0Free
Bạn đang xem trước 20 trang mẫu tài liệu Bài giảng Biology - Chapter 18: Genomics, để tải tài liệu gốc về máy bạn click vào nút DOWNLOAD ở trên
GenomicsChapter 181Mapping GenomesMaps of genomes can be divided into 2 types -Genetic maps -Abstract maps that place the relative location of genes on chromosomes based on recombination frequency -Physical maps -Use landmarks within DNA sequences, ranging from restriction sites to the actual DNA sequence2Physical MapsDistances between “landmarks” are measured in base-pairs -1000 basepairs (bp) = 1 kilobase (kb)Knowledge of DNA sequence is not necessaryThere are three main types of physical maps -Restriction maps -Cytological maps -Radiation hybrid maps3Physical MapsRestriction maps -The first physical maps -Based on distances between restriction sites -Overlap between smaller segments can be used to assemble them into a contig -Continuous segment of the genome4MolecularweightmarkerAAAABBB14 kb5 kbAA8 kb9 kb2 kb9 kb5 kb3 kb2 kb2 kb2 kb2 kb2 kb3 kb6 kb5 kb5 kb5 kb10 kb10 kb19 kb9 kb9 kb8 kb14 kb14 kb1. Multiple copies of a segment of DNA are cut with restriction enzymes.2. The fragments produced by enzyme A only, by enzyme B only, and by enzymes A and B together are run side-by-side on a gel, which separates them according to size.3. The fragments are arranged so that the smaller ones produced by the simultaneous cut can be grouped to generate the larger ones produced by the individual enzymes.4. A physical map is constructed.DNA0enzyme Aenzyme A + Benzyme BCopyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.5Physical MapsCytological maps -Employ stains that generate reproducible patterns of bands on the chromosomes -Divide chromosomes into subregions -Provide a map of the whole genome, but at low resolution -Cloned DNA is correlated with map using fluorescent in situ hybridization (FISH)6Physical Maps7Physical MapsRadiation hybrid maps -Use radiation to fragment chromosomes randomly -Fragments are then recovered by fusing irradiated cell to another cell -Usually a rodent cell -Fragments can be identified based on banding patterns or FISH8Physical MapsSequence-tagged sites -An STS is a small stretch of DNA that is unique in the genome -Only 200-500 bp -Boundary is defined by PCR primers -Identified using any DNA as a template -STSs essentially provide a scaffold for assembling genome sequences 93. The presence or absence of each STS in the clones identifies regions of overlap. The final result is a contiguous sequence (contig) of overlapping clones.Clone AClone BClone CClone DSTS 1STS 2STS 2STS 3STS 2STS 3STS 4STS 3STS 4ContigSTS 1STS 2STS 3STS 42. The products of the PCR reactions are separated by gel electrophoresis producing a different size fragment for each STS.STS 1STS 2STS 3STS 4Clone AClone BClone CClone DShorterfragmentsLongerfragmentsPCR runs with four clones1. The location of 4 STSs in the genome is shown. PCR is used to amplify each STS from different clones in a library. Amplifying each STS by PCR generates a unique fragment that can be identified.STS 1STS 2STS 3STS 4DNASTS sitesPCR primersCopyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.10Genetic MapsGenetic maps are measured in centimorgans -1 cM = 1% recombination frequencyLinkage mapping can be done without knowing the DNA sequence of a gene -Limitations: 1. Genetic distance does not directly correspond to actual physical distance 2. Not all genes have obvious phenotypes11Genetic MapsMost common markers are short repeat sequences called, short tandem repeats, or STR loci -Differ in repeat length between individuals -13 form the basis of modern DNA fingerprinting developed by the FBI -Cataloged in the CODIS database to identify criminal offenders12Genetic MapsGenetic and physical maps can be correlated -Any cloned gene can be placed within the genome and can also be mapped genetically13Genetic MapsAll of these different kinds of maps are stored in databases -The National Center for Biotechnology Information (NCBI) serves as the US repository for these data and more -Similar databases exist in Europe and Japan14Whole Genome SequencingThe ultimate physical map is the base-pair sequence of the entire genome -Requires use of high-throughout automated sequencing and computer analysis15Whole Genome SequencingSequencers provide accurate sequences for DNA segments up to 800 bp long -To reduce errors, 5-10 copies of a genome are sequenced and comparedVectors use to clone large pieces of DNA: -Yeast artificial chromosomes (YACs) -Bacterial artificial chromosomes (BACs) -Human artificial chromosomes (HACs) -Are circular, at present16Whole Genome SequencingClone-by-clone sequencing -Overlapping regions between BAC clones are identified by restriction mapping or STS analysisShotgun sequencing -DNA is randomly cut into smaller fragments, cloned and then sequenced -Computers put together the overlaps -Sequence is not tied to other information17a.b.Clone-by-Clone MethodShotgun Method3. The entire sequence is assembled from the overlapping larger clones.2. Large clones are fragmented into smaller clones for sequencing.1. Large DNA clones are first isolated. These are arranged into contiguous sequences based on overlapping tagged sites.1. Cut DNA of entire chromosome into small fragments and clone.2. Sequence each segment and arrange based on overlapping nucleotide sequences.Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.18The Human Genome ProjectOriginated in 1990 by the International Human Genome Sequencing ConsortiumCraig Venter formed a private company, and entered the “race” in May, 1998In 2001, both groups published a draft sequence -Contained numerous gaps19The Human Genome ProjectIn 2004, the “finished” sequence was published as the reference sequence (REF-SEQ) in databases -3.2 gigabasepairs -1 Gb = 1 billion basepairs -Contains a 400-fold reduction in gaps -99% of euchromatic sequence -Error rate = 1 per 100,000 bases20Characterizing GenomesThe Human Genome Project found fewer genes than expected -Initial estimate was 100,000 genes -Number now appears to be about 25,000!In general, eukaryotic genomes are larger and have more genes than those of prokaryotes -However, the complexity of an organism is not necessarily related to its gene number21Characterizing Genomes22Finding GenesGenes are identified by open reading frames -An ORF begins with a start codon and contains no stop codon for a distance long enough to encode a proteinSequence annotation -The addition of information, such as ORFs, to the basic sequence information23Finding GenesBLAST -A search algorithm used to search NCBI databases for homologous sequences -Permits researchers to infer functions for isolated molecular clones Bioinformatics -Use of computer programs to search for genes, and to assemble and compare genomes24Genome OrganizationGenomes consist of two main regions -Coding DNA -Contains genes than encode proteins -Noncoding DNA -Regions that do not encode proteins25Coding DNA in EukaryotesFour different classes are found: -Single-copy genes : Includes most genes -Segmental duplications : Blocks of genes copied from one chromosome to another -Multigene families : Groups of related but distinctly different genes -Tandem clusters : Identical copies of genes occurring together in clusters -Also include rRNA genes 26Noncoding DNA in EukaryotesEach cell in our bodies has about 6 feet of DNA stuffed into it -However, less than one inch is devoted to genes!Six major types of noncoding human DNA have been described27Noncoding DNA in EukaryotesNoncoding DNA within genes -Protein-encoding exons are embedded within much larger noncoding intronsStructural DNA -Called constitutive heterochromatin -Localized to centromeres and telomeresSimple sequence repeats (SSRs) -One- to six-nucleotide sequences repeated thousands of times28Noncoding DNA in EukaryotesSegmental duplications -Consist of 10,000 to 300,000 bp that have duplicated and movedPseudogenes -Inactive genes 29Noncoding DNA in EukaryotesTransposable elements (transposons) -Mobile genetic elements -Four types: -Long interspersed elements (LINEs) -Short interspersed elements (SINEs) -Long terminal repeats (LTRs) -Dead transposons30Noncoding DNA in Eukaryotes31Expressed Sequence TagsESTs can identify genes that are expressed -They are generated by sequencing the ends of randomly selected cDNAs ESTs have identified 87,000 cDNAs in different human tissues -But how can 25,000 human genes encode three to four times as many proteins? -Alternative splicing yields different proteins with different functions32Alternative Splicing13456891012124568910132345687910111213Primary RNA transcriptMature mRNA in brain3´ poly-A tail3´ poly-A tailProcessed RNA in brainProcessed RNA in musclemRNA splicingMature mRNA in muscle3´poly-A tail5´ cap5´ capexonsintrons5´ cap33Variation in the Human GenomeSingle-nucleotide polymorphisms (SNPs) are sites where individuals differ by only one nucleotide -Must be found in at least 1% of populationHaplotypes are regions of the chromosome that are not exchanged by recombination -Tendency for genes not to be randomized is called linkage disequilibrium -Can be used to map genes34b.TCGGTCTCGGTATAAGCCCCGACTTGATGATGGTChromosome 1SNPSNPSNPSNPsDiagnostic SNPsHaplotype 1HaplotypesHaplotype 2Haplotype 3Haplotype 4Chromosome 2Chromosome 3Chromosome 4a.AACAAAATTTCCCGCTCAAAGTACGGTGTAAGCCTTGACGGTCHaplotype 1Haplotype 2Haplotype 3Haplotype 4ATCACGAGTGCTCAACAATAAGTGTCAA/GT/CC/GCCCCTCCCGGGGGGGAACAAAATTTCCCGCCTCCCGGAGAGGAACAAAATTTTCCGCCTCCCGGAGGGGAACAAAATTTCCCGCCTCCCGGGGGGGCopyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.35GenomicsComparative genomics, the study of whole genome maps of organisms, has revealed similarities among them -For example, over half of Drosophila genes have human counterpartsSynteny refers to the conserved arrangements of DNA segments in related genomes -Allows comparisons of unsequenced genomes36Genomics37Genomic Alignment (Segment Rearrangement)Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.RiceSugarcaneCornWheat38GenomicsOrganellar genomes -Mitochondria and chloroplasts are descendants of ancient endosymbiotic bacterial cells -Over time, their genomes exchanged genes with the nuclear genome -Both organelles contain polypeptides encoded by the nucleus39GenomicsFunctional genomics is the study of the function of genes and their productsDNA microarrays (“gene chips”) enable the analysis of gene expression at the whole-genome level -DNA fragments are deposited on a slide -Probed with labeled mRNA from different sources -Active/inactive genes are identified40DNA microarrayDNAFlower-specific mRNA(sample 1)Reverse transcriptaseFluorescent nucleotideReverse transcriptaseDifferent fluorescent nucleotidecDNA probecDNA probeLeaf-specific mRNA(sample 2)Probe 1Probe 2Strongsignal fromprobe Weaksignal fromprobe 2Strongsignalfromprobe 1Weaksignalfromprobe 1Similarsignals fromboth probesMixHybridize3. Samples of mRNA are obtained from two different tissues. Probes for each sample are prepared using a different fluorescent nucleotide for each sample.2. DNA is printed onto a microscope slide.RoboticquillMicroscopeslidePlate containinggenome fragments13421. Unique, PCR-amplified Arabidopsis genome fragments (1, 2, 3, 4...) are contained in each well of a plate.12344. The two probes are mixed and hybridized with the microarray. Fluorescent signals on the microarray are analyzed.Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.41GenomicsTransgenics is the creation of organisms containing genes from other species (transgenic organisms -Can be used to determine whether: -A gene identified by an annotation program is really functional in vivo -Homologous genes from different species have the same function42Genomics43ProteomicsProteomics is the study of the proteome -All the proteins encoded by the genomeThe transcriptome consists of all the RNA that is present in a cell or tissue44ProteomicsProteins are much more difficult to study than DNA because of: -Post-translational modifications -Alternative splicing However, databases containing the known protein structural motifs exist -These can be searched to predict the structure and function of gene sequences45Proteomics46ProteomicsProtein microarrays are being used to study large numbers of proteins simultaneously -Can be probed using: -Antibodies to specific proteins -Specific proteins -Small moleculesThe yeast two-hybrid system has generated large-scale maps of interacting proteins47Applications of GenomicsThe genomics revolution will have a lasting effect on how we think about living systemsThe immediate impact of genomics is being seen in diagnostics -Identifying genetic abnormalities -Identifying victims by their remains -Distinguishing between naturally occurring and intentional outbreaks of infections48Applications of Genomics49Applications of GenomicsGenomics has also helped in agriculture -Improvement in the yield and nutritional quality of rice -Doubling of world grain production in last 50 years, with only a 1% cropland increase50Applications of GenomicsGenome science is also a source of ethical challenges and dilemmas -Gene patents -Should the sequence/use of genes be freely available or can it be patented? -Privacy concerns -Could one be discriminated against because their SNP profile indicates susceptibility to a disease?51
Các file đính kèm theo tài liệu này:
chapter_18_lecture_9757.ppt