Tài liệu Bài giảng Biology - Chapter 17: From Gene to Protein: Chapter 17From Gene to ProteinOverview: The Flow of Genetic Information The information content of DNAIs in the form of specific sequences of nucleotides along the DNA strandsThe DNA inherited by an organismLeads to specific traits by dictating the synthesis of proteinsThe process by which DNA directs protein synthesis, gene expressionIncludes two stages, called transcription and translationThe ribosomeIs part of the cellular machinery for translation, polypeptide synthesisFigure 17.1Concept 17.1: Genes specify proteins via transcription and translation Evidence from the Study of Metabolic DefectsIn 1909, British physician Archibald GarrodWas the first to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions in the cellNutritional Mutants in Neurospora: Scientific InquiryBeadle and Tatum causes bread mold to mutate with X-raysCreating mutants that could not survive on minimal mediumUsing genetic crossesThey determined that their mutants fell in...
70 trang |
Chia sẻ: honghanh66 | Lượt xem: 1050 | Lượt tải: 0Free
Bạn đang xem trước 20 trang mẫu tài liệu Bài giảng Biology - Chapter 17: From Gene to Protein, để tải tài liệu gốc về máy bạn click vào nút DOWNLOAD ở trên
Chapter 17From Gene to ProteinOverview: The Flow of Genetic Information The information content of DNAIs in the form of specific sequences of nucleotides along the DNA strandsThe DNA inherited by an organismLeads to specific traits by dictating the synthesis of proteinsThe process by which DNA directs protein synthesis, gene expressionIncludes two stages, called transcription and translationThe ribosomeIs part of the cellular machinery for translation, polypeptide synthesisFigure 17.1Concept 17.1: Genes specify proteins via transcription and translation Evidence from the Study of Metabolic DefectsIn 1909, British physician Archibald GarrodWas the first to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions in the cellNutritional Mutants in Neurospora: Scientific InquiryBeadle and Tatum causes bread mold to mutate with X-raysCreating mutants that could not survive on minimal mediumUsing genetic crossesThey determined that their mutants fell into three classes, each mutated in a different geneFigure 17.2Working with the mold Neurospora crassa, George Beadle and Edward Tatum had isolated mutants requiring arginine in their growth medium and had shown genetically that these mutants fell into three classes, each defective in a different gene. From other considerations, they suspected that the metabolic pathway of arginine biosynthesis included the precursors ornithine and citrulline. Their most famous experiment, shown here, tested both their one gene–one enzyme hypothesis and their postulated arginine pathway. In this experiment, they grew their three classes of mutants under the four different conditions shown in the Results section below.The wild-type strain required only the minimal medium for growth. The three classes of mutants had different growth requirements EXPERIMENTRESULTSClass IMutantsClass IIMutantsClass IIIMutantsWild typeMinimal medium(MM)(control)MM +OrnithineMM +CitrullineMM +Arginine(control)CONCLUSIONFrom the growth patterns of the mutants, Beadle and Tatum deduced that each mutant was unable to carry out one step in the pathway for synthesizing arginine, presumably because it lacked the necessary enzyme. Because each of their mutants was mutated in a single gene, they concluded that each mutated gene must normally dictate the production of one enzyme. Their results supported the one gene–one enzyme hypothesis and also confirmed the arginine pathway. (Notice that a mutant can grow only if supplied with a compound made after the defective step.)Class IMutants(mutationin gene A)Class IIMutants(mutationin gene B)Class IIIMutants(mutationin gene C)Wild typeGene AGene BGene CPrecursorPrecursorPrecursorPrecursorOrnithineOrnithineOrnithineOrnithineCitrullineCitrullineCitrullineCitrullineArginineArginineArginineArginineEnzymeAEnzymeBEnzymeCAAABBBCCCBeadle and Tatum developed the “one gene–one enzyme hypothesis”Which states that the function of a gene is to dictate the production of a specific enzymeThe Products of Gene Expression: A Developing StoryAs researchers learned more about proteinsThe made minor revision to the one gene–one enzyme hypothesisGenes code for polypeptide chains or for RNA moleculesBasic Principles of Transcription and TranslationTranscriptionIs the synthesis of RNA under the direction of DNAProduces messenger RNA (mRNA)TranslationIs the actual synthesis of a polypeptide, which occurs under the direction of mRNAOccurs on ribosomesIn prokaryotesTranscription and translation occur togetherFigure 17.3aProkaryotic cell. In a cell lacking a nucleus, mRNAproduced by transcription is immediately translatedwithout additional processing.(a)TRANSLATIONTRANSCRIPTIONDNAmRNARibosomePolypeptideIn eukaryotesRNA transcripts are modified before becoming true mRNAFigure 17.3bEukaryotic cell. The nucleus provides a separatecompartment for transcription. The original RNAtranscript, called pre-mRNA, is processed in various ways before leaving the nucleus as mRNA.(b)TRANSCRIPTIONRNA PROCESSINGTRANSLATIONmRNADNAPre-mRNAPolypeptideRibosomeNuclearenvelopeCells are governed by a cellular chain of commandDNA RNA proteinThe Genetic CodeHow many bases correspond to an amino acid?Codons: Triplets of BasesGenetic informationIs encoded as a sequence of nonoverlapping base triplets, or codonsDuring transcriptionThe gene determines the sequence of bases along the length of an mRNA moleculeFigure 17.4DNAmoleculeGene 1Gene 2Gene 3DNA strand(template)TRANSCRIPTIONmRNAProteinTRANSLATIONAmino acidACCAAACCGAGTUGGUUUGGCUCATrpPheGlySerCodon3535Cracking the CodeA codon in messenger RNAIs either translated into an amino acid or serves as a translational stop signalFigure 17.5Second mRNA baseUCAGUCAGUUUUUCUUAUUGCUUCUCCUACUGAUUAUCAUAAUGGUUGUCGUAGUGMet orstartPheLeuLeulleValUCUUCCUCAUCGCCUCCCCCACCGACUACCACAACGGCUGCCGCAGCGSerProThrAlaUAUUACUGUUGCTyrCysCAUCACCAACAGCGUCGCCGACGGAAUAACAAAAAGAGUAGCAGAAGGGAUGACGAAGAGGGUGGCGGAGGGUGGUAAUAGStopStopUGAStopTrpHisGlnAsnLysAspArgSerArgGlyUCAGUCAGUCAGUCAGFirst mRNA base (5 end)Third mRNA base (3 end)GluCodons must be read in the correct reading frameFor the specified polypeptide to be producedEvolution of the Genetic CodeThe genetic code is nearly universalShared by organisms from the simplest bacteria to the most complex animalsIn laboratory experimentsGenes can be transcribed and translated after being transplanted from one species to anotherFigure 17.6Concept 17.2: Transcription is the DNA-directed synthesis of RNA: a closer lookMolecular Components of TranscriptionRNA synthesisIs catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotidesFollows the same base-pairing rules as DNA, except that in RNA, uracil substitutes for thymineSynthesis of an RNA TranscriptThe stages of transcription areInitiationElongationTerminationFigure 17.7PromoterTranscription unitRNA polymeraseStart point533535535335533555RewoundRNARNAtranscript33Completed RNA transcriptUnwoundDNARNAtranscriptTemplate strand of DNADNA1Initiation. After RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point on the template strand.2Elongation. The polymerase moves downstream, unwinding theDNA and elongating the RNA transcript 5 3 . In the wake of transcription, the DNA strands re-form a double helix.3Termination. Eventually, the RNAtranscript is released, and the polymerase detaches from the DNA.ElongationRNApolymeraseNon-templatestrand of DNARNA nucleotides3 endCAE GCAAUTAGGTTAACGUATCATCCAATTGG355Newly madeRNADirection of transcription(“downstream”)Templatestrand of DNARNA Polymerase Binding and Initiation of TranscriptionPromoters signal the initiation of RNA synthesisTranscription factorsHelp eukaryotic RNA polymerase recognize promoter sequencesFigure 17.8Figure 17.8TRANSCRIPTIONRNA PROCESSINGTRANSLATIONDNAPre-mRNAmRNARibosomePolypeptideTATAAAAATATTTTTATA boxStart pointTemplateDNA strand5335Transcriptionfactors5335Promoter53355RNA polymerase IITranscription factorsRNA transcriptTranscription initiation complexEukaryotic promoters1Several transcriptionfactors2Additional transcriptionfactors3Elongation of the RNA StrandAs RNA polymerase moves along the DNAIt continues to untwist the double helix, exposing about 10 to 20 DNA bases at a time for pairing with RNA nucleotidesTermination of TranscriptionThe mechanisms of terminationAre different in prokaryotes and eukaryotesConcept 17.3: Eukaryotic cells modify RNA after transcriptionEnzymes in the eukaryotic nucleusModify pre-mRNA in specific ways before the genetic messages are dispatched to the cytoplasmAlteration of mRNA EndsEach end of a pre-mRNA molecule is modified in a particular wayThe 5 end receives a modified nucleotide capThe 3 end gets a poly-A tailFigure 17.9A modified guanine nucleotideadded to the 5 end50 to 250 adenine nucleotidesadded to the 3 endProtein-coding segmentPolyadenylation signalPoly-A tail3 UTRStop codonStart codon5 Cap5 UTRAAUAAAAAAAAATRANSCRIPTIONRNA PROCESSINGDNAPre-mRNAmRNATRANSLATIONRibosomePolypeptideGPPP53Split Genes and RNA SplicingRNA splicingRemoves introns and joins exons Figure 17.10TRANSCRIPTIONRNA PROCESSINGDNAPre-mRNAmRNATRANSLATIONRibosomePolypeptide5 CapExonIntron153031ExonIntron104105146Exon3Poly-A tailPoly-A tailIntrons cut out andexons spliced togetherCodingsegment5 Cap11463 UTR3 UTRPre-mRNAmRNAIs carried out by spliceosomes in some casesFigure 17.11RNA transcript (pre-mRNA)Exon 1IntronExon 2Other proteinsProteinsnRNAsnRNPsSpliceosomeSpliceosomecomponentsCut-outintronmRNAExon 1Exon 2555123RibozymesRibozymesAre catalytic RNA molecules that function as enzymes and can splice RNAThe Functional and Evolutionary Importance of IntronsThe presence of intronsAllows for alternative RNA splicingProteins often have a modular architectureConsisting of discrete structural and functional regions called domainsIn many casesDifferent exons code for the different domains in a proteinFigure 17.12GeneDNAExon 1IntronExon 2IntronExon 3TranscriptionRNA processingTranslationDomain 3Domain 1Domain 2PolypeptideConcept 17.4: Translation is the RNA-directed synthesis of a polypeptide: a closer lookMolecular Components of TranslationA cell translates an mRNA message into proteinWith the help of transfer RNA (tRNA)Translation: the basic conceptFigure 17.13TRANSCRIPTIONTRANSLATIONDNAmRNARibosomePolypeptidePolypeptideAminoacidstRNA withamino acidattachedRibosometRNAAnticodonmRNATrpPheGlyAGCAAACCGUGGUUUGGCCodons53Molecules of tRNA are not all identicalEach carries a specific amino acid on one endEach has an anticodon on the other endThe Structure and Function of Transfer RNAACCA tRNA moleculeConsists of a single RNA strand that is only about 80 nucleotides longIs roughly L-shapedFigure 17.14aTwo-dimensional structure. The four base-paired regions and three loops are characteristic of all tRNAs, as is the base sequence of the amino acid attachment site at the 3 end. The anticodon triplet is unique to each tRNA type. (The asterisks mark bases that have been chemically modified, a characteristic of tRNA.)(a)3CCACGCUUAAGACACCU*GC**GUGU*CU*GAGGU**A*AAGUCAGACC*CGAGAGGG**GACUC*AUUUAGGCG5Amino acidattachment siteHydrogenbondsAnticodonAFigure 17.14b(b) Three-dimensional structureSymbol used in this bookAmino acidattachment siteHydrogen bondsAnticodonAnticodonAAG5335(c)A specific enzyme called an aminoacyl-tRNA synthetaseJoins each amino acid to the correct tRNAFigure 17.15Amino acidATPAdenosinePyrophosphateAdenosineAdenosinePhosphatestRNAPPPPPPiPiPiPAMPAminoacyl tRNA(an “activatedamino acid”)Aminoacyl-tRNAsynthetase (enzyme) Active site binds theamino acid and ATP. 1 ATP loses two P groupsand joins amino acid as AMP.23 AppropriatetRNA covalentlyBonds to aminoAcid, displacingAMP. Activated amino acidis released by the enzyme.4RibosomesRibosomesFacilitate the specific coupling of tRNA anticodons with mRNA codons during protein synthesisThe ribosomal subunitsAre constructed of proteins and RNA molecules named ribosomal RNA or rRNAFigure 17.16aTRANSCRIPTIONTRANSLATIONDNAmRNARibosomePolypeptideExit tunnelGrowingpolypeptidetRNAmoleculesEPALargesubunitSmallsubunitmRNAComputer model of functioning ribosome. This is a model of a bacterial ribosome, showing its overall shape. The eukaryotic ribosome is roughly similar. A ribosomal subunit is an aggregate of ribosomal RNA molecules and proteins.(a)53The ribosome has three binding sites for tRNAThe P siteThe A siteThe E siteFigure 17.16bEPAP site (Peptidyl-tRNAbinding site)E site (Exit site)mRNAbinding siteA site (Aminoacyl-tRNA binding site)LargesubunitSmallsubunitSchematic model showing binding sites. A ribosome has an mRNA binding site and three tRNA binding sites, known as the A, P, and E sites. This schematic ribosome will appear in later diagrams.(b)Figure 17.16cAmino endGrowing polypeptideNext amino acidto be added topolypeptide chaintRNAmRNACodons35Schematic model with mRNA and tRNA. A tRNA fits into a binding site when its anticodon base-pairs with an mRNA codon. The P site holds the tRNA attached to the growing polypeptide. The A site holds the tRNA carrying the next amino acid to be added to the polypeptide chain. Discharged tRNA leaves via the E site.(c)Building a PolypeptideWe can divide translation into three stagesInitiationElongationTerminationRibosome Association and Initiation of TranslationThe initiation stage of translationBrings together mRNA, tRNA bearing the first amino acid of the polypeptide, and two subunits of a ribosomeLargeribosomalsubunitThe arrival of a large ribosomal subunit completes the initiation complex. Proteins called initiationfactors (not shown) are required to bring all the translation components together. GTP provides the energy for the assembly. The initiator tRNA is in the P site; the A site is available to the tRNA bearing the next amino acid.2Initiator tRNAmRNAmRNA binding siteSmallribosomalsubunitTranslation initiation complexP siteGDPGTPStart codonA small ribosomal subunit binds to a molecule of mRNA. In a prokaryotic cell, the mRNA binding site on this subunit recognizes a specific nucleotide sequence on the mRNA just upstream of the start codon. An initiator tRNA, with the anticodon UAC, base-pairs with the start codon, AUG. This tRNA carries the amino acid methionine (Met). 1MetMetUACAUGEA35533535Figure 17.17Elongation of the Polypeptide ChainIn the elongation stage of translationAmino acids are added one by one to the preceding amino acidFigure 17.18Amino endof polypeptidemRNARibosome ready fornext aminoacyl tRNAEPAEPAEPAEPAGDPGTPGTPGDP22sitesite53TRANSCRIPTIONTRANSLATIONDNAmRNARibosomePolypeptide Codon recognition. The anticodon of an incoming aminoacyl tRNA base-pairs with the complementary mRNA codon in the A site. Hydrolysisof GTP increases the accuracy andefficiency of this step.1 Peptide bond formation. An rRNA molecule of the large subunit catalyzes the formation of a peptide bond between the new amino acid in the A site and the carboxyl end of the growing polypeptide in the P site. This step attaches the polypeptide to the tRNA in the A site.2 Translocation. The ribosome translocates the tRNA in the A site to the P site. The empty tRNA in the P site is moved to the E site, where it is released. The mRNA moves along with its bound tRNAs,bringing the next codon to be translated into the A site.3Termination of TranslationThe final stage of translation is terminationWhen the ribosome reaches a stop codon in the mRNAFigure 17.19Release factorFreepolypeptideStop codon(UAG, UAA, or UGA)533535When a ribosome reaches a stop codon on mRNA, the A site of the ribosome accepts a protein called a release factor instead of tRNA.1The release factor hydrolyzes the bond between the tRNA in the P site and the last amino acid of the polypeptide chain. The polypeptide is thus freed from the ribosome.23The two ribosomal subunits and the other components of the assembly dissociate.PolyribosomesA number of ribosomes can translate a single mRNA molecule simultaneouslyForming a polyribosomeFigure 17.20a, bGrowingpolypeptidesCompletedpolypeptideIncomingribosomalsubunitsStart of mRNA(5 end)End of mRNA(3 end)PolyribosomeAn mRNA molecule is generally translated simultaneously by several ribosomes in clusters called polyribosomes.(a)RibosomesmRNAThis micrograph shows a large polyribosome in a prokaryotic cell (TEM).0.1 µm(b)Completing and Targeting the Functional ProteinPolypeptide chainsUndergo modifications after the translation processProtein Folding and Post-Translational ModificationsAfter translationProteins may be modified in ways that affect their three-dimensional shapeTargeting Polypeptides to Specific LocationsTwo populations of ribosomes are evident in cellsFree and boundFree ribosomes in the cytosolInitiate the synthesis of all proteinsProteins destined for the endomembrane system or for secretionMust be transported into the ERHave signal peptides to which a signal-recognition particle (SRP) binds, enabling the translation ribosome to bind to the ERFigure 17.21RibosomemRNASignalpeptideSignal-recognitionparticle(SRP)SRPreceptorproteinTranslocationcomplexCYTOSOLSignalpeptideremovedERmembraneProteinERLUMENThe signal mechanism for targeting proteins to the ER Polypeptidesynthesis beginson a freeribosome inthe cytosol.1 An SRP binds to the signal peptide, halting synthesismomentarily.2 The SRP binds to areceptor protein in the ERmembrane. This receptoris part of a protein complex(a translocation complex)that has a membrane poreand a signal-cleaving enzyme.3 The SRP leaves, andthe polypeptide resumesgrowing, meanwhiletranslocating across themembrane. (The signalpeptide stays attachedto the membrane.)4 The signal-cleaving enzymecuts off thesignal peptide.5 The rest ofthe completedpolypeptide leaves the ribosome andfolds into its finalconformation.6Concept 17.5: RNA plays multiple roles in the cell: a reviewRNACan hydrogen-bond to other nucleic acid moleculesCan assume a specific three-dimensional shapeHas functional groups that allow it to act as a catalystTypes of RNA in a Eukaryotic CellTable 17.1Concept 17.6: Comparing gene expression in prokaryotes and eukaryotes reveals key differencesProkaryotic cells lack a nuclear envelopeAllowing translation to begin while transcription is still in progressFigure 17.22DNAPolyribosomemRNADirection oftranscription0.25 mRNApolymerasePolyribosomeRibosomeDNAmRNA (5 end)RNA polymerasePolypeptide(amino end)In a eukaryotic cellThe nuclear envelope separates transcription from translationExtensive RNA processing occurs in the nucleusConcept 17.7: Point mutations can affect protein structure and functionMutationsAre changes in the genetic material of a cellPoint mutationsAre changes in just one base pair of a geneThe change of a single nucleotide in the DNA’s template strandLeads to the production of an abnormal proteinFigure 17.23In the DNA, themutant templatestrand has an A where the wild-type template has a T.The mutant mRNA has a U instead of an A in one codon.The mutant (sickle-cell) hemoglobin has a valine (Val) instead of a glutamic acid (Glu).Mutant hemoglobin DNAWild-type hemoglobin DNAmRNAmRNANormal hemoglobinSickle-cell hemoglobinGluValCTTCATGAAGUA35355353Types of Point MutationsPoint mutations within a gene can be divided into two general categoriesBase-pair substitutionsBase-pair insertions or deletionsSubstitutionsA base-pair substitutionIs the replacement of one nucleotide and its partner with another pair of nucleotidesCan cause missense or nonsenseFigure 17.24Wild typeAUGAAGUUUGGCUAAmRNA5ProteinMetLysPheGlyStopCarboxyl endAmino end3AUGAAGUUUGGUUAAMetLysPheGlyBase-pair substitutionNo effect on amino acid sequenceU instead of CStopAUGAAGUUUAGUUAAMetLysPheSerStopAUGUAGUUUGGCUAAMetStopMissenseA instead of GNonsenseU instead of AInsertions and DeletionsInsertions and deletionsAre additions or losses of nucleotide pairs in a geneMay produce frameshift mutationsFigure 17.25mRNAProteinWild typeAUGAAGUUUGGCUAA5MetLysPheGlyAmino endCarboxyl endStopBase-pair insertion or deletionFrameshift causing immediate nonsenseAUGUAAGUUUGGCUAAUGAAGUUGGCUAAAUGUUUGGCUAAMetStopUMetLysLeuAlaMetPheGlyStopMissingAAGMissingExtra UFrameshift causing extensive missenseInsertion or deletion of 3 nucleotides:no frameshift but extra or missing amino acid3MutagensSpontaneous mutationsCan occur during DNA replication, recombination, or repairMutagensAre physical or chemical agents that can cause mutationsWhat is a gene? revisiting the questionA geneIs a region of DNA whose final product is either a polypeptide or an RNA moleculeA summary of transcription and translation in a eukaryotic cellFigure 17.26TRANSCRIPTION RNA is transcribedfrom a DNA template.DNARNApolymeraseRNAtranscriptRNA PROCESSING In eukaryotes, theRNA transcript (pre-mRNA) is spliced andmodified to producemRNA, which movesfrom the nucleus to thecytoplasm.ExonPoly-ARNA transcript(pre-mRNA)IntronNUCLEUSCapFORMATION OFINITIATION COMPLEX After leaving thenucleus, mRNA attachesto the ribosome.CYTOPLASMmRNAPoly-AGrowingpolypeptideRibosomalsubunitsCapAminoacyl-tRNAsynthetaseAminoacidtRNAAMINO ACID ACTIVATION Each amino acidattaches to its proper tRNAwith the help of a specificenzyme and ATP.Activatedamino acidTRANSLATION A succession of tRNAsadd their amino acids tothe polypeptide chainas the mRNA is movedthrough the ribosomeone codon at a time.(When completed, thepolypeptide is releasedfrom the ribosome.)AnticodonACCAAAUGGUUUAUGUACEARibosome1Poly-A553Codon2345
Các file đính kèm theo tài liệu này:
chapter17_7274.ppt