Định típ phức hợp kháng nguyên bạch cầu người (HLA: Human Leukocyte Antigen) Locus B bằng phương pháp giải trình tự gen kết hợp với tạo dòng

Tài liệu Định típ phức hợp kháng nguyên bạch cầu người (HLA: Human Leukocyte Antigen) Locus B bằng phương pháp giải trình tự gen kết hợp với tạo dòng: Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 4 * 2019 Nghiên cứu Y học Hội Nghị Khoa Học Nhi Khoa BV. Nhi Đồng 1 219 ĐỊNH TÍP PHỨC HỢP KHÁNG NGUYÊN BẠCH CẦU NGƯỜI (HLA: HUMAN LEUKOCYTE ANTIGEN) LOCUS B BẰNG PHƯƠNG PHÁP GIẢI TRÌNH TỰ GEN KẾT HỢP VỚI TẠO DÒNG Mai Phương Thảo*, Lê Gia Hoàng Linh**, Nguyễn Thế Vinh**, Hoàng Anh Vũ**, Đỗ Đức Minh** TÓM TẮT Mục tiêu: Phức hợp kháng nguyên bạch cầu người (HLA: human leukocyte antigen) là phức hợp các protein màng tế bào đóng vai trò quan trọng trong điều hòa miễn dịch. Định típ HLA rất cần thiết cho việc ghép tạng cũng như ghép tế bào gốc. Giải trình tự Sanger là một công cụ giúp định típ HLA chính xác, độ phân giải cao và đang được thực hiện trên toàn thế giới. Đối tượng và phương pháp: Có 20 đối tượng tình nguyện tham gia nghiên cứu được định típ HLA locus B bằng phương pháp giải trình tự Sanger kết hợp với tạo dòng. Kết quả: Chúng tôi phát hiện 3 trường hợp mang alen HLA-B đồng hợp tử và 17 trường hợp dị hợp tử. Các ...

pdf7 trang | Chia sẻ: Đình Chiến | Ngày: 29/06/2023 | Lượt xem: 202 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Định típ phức hợp kháng nguyên bạch cầu người (HLA: Human Leukocyte Antigen) Locus B bằng phương pháp giải trình tự gen kết hợp với tạo dòng, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 4 * 2019 Nghiên cứu Y học Hội Nghị Khoa Học Nhi Khoa BV. Nhi Đồng 1 219 ĐỊNH TÍP PHỨC HỢP KHÁNG NGUYÊN BẠCH CẦU NGƯỜI (HLA: HUMAN LEUKOCYTE ANTIGEN) LOCUS B BẰNG PHƯƠNG PHÁP GIẢI TRÌNH TỰ GEN KẾT HỢP VỚI TẠO DÒNG Mai Phương Thảo*, Lê Gia Hoàng Linh**, Nguyễn Thế Vinh**, Hoàng Anh Vũ**, Đỗ Đức Minh** TÓM TẮT Mục tiêu: Phức hợp kháng nguyên bạch cầu người (HLA: human leukocyte antigen) là phức hợp các protein màng tế bào đóng vai trò quan trọng trong điều hòa miễn dịch. Định típ HLA rất cần thiết cho việc ghép tạng cũng như ghép tế bào gốc. Giải trình tự Sanger là một công cụ giúp định típ HLA chính xác, độ phân giải cao và đang được thực hiện trên toàn thế giới. Đối tượng và phương pháp: Có 20 đối tượng tình nguyện tham gia nghiên cứu được định típ HLA locus B bằng phương pháp giải trình tự Sanger kết hợp với tạo dòng. Kết quả: Chúng tôi phát hiện 3 trường hợp mang alen HLA-B đồng hợp tử và 17 trường hợp dị hợp tử. Các alen HLA-B được xác định bao gồm 07:02, 07:05, 13:01, 15:01, 15:02, 15:12, 15:25, 15:27, 15:35, 18:02, 27:06, 35:05, 38:02, 40:01, 44:03, 46:01, 55:02, 56:01, 57:01, 58:01. Kết luận: Kỹ thuật giải trình tự Sanger là một kỹ thuật định típ HLA chính xác và tiết kiệm chi phí. Từ khóa: phức hợp kháng nguyên bạch cầu người (HLA), giải trình tự thế hệ mới, phản ứng PCR, giải trình tự Sanger, tạo dòng ABSTRACT HUMAN LEUKOCYTE ANTIGEN LOCUS B (HLA-B) TYPING BY SANGER SEQUENCING AND CLONING Mai Phuong Thao, Le Gia Hoang Linh, Nguyen The Vinh, Hoang Anh Vu, Do Duc Minh * Ho Chi Minh City Journal of Medicine * Supplement of Vol. 23 – No. 4 - 2019: 219 – 225 Objectives: Human leukocyte antigen, a cell-surface protein complex, is responsible for the regulation of the immune system. HLA typing is neccesary step in stem cell and organ transplantation. Sanger sequencing is an accurate tool that can provide high resolution typing and has been applied worldwide. Methods: HLA-B 20 objects participated in the study were sequenced and cloned if nessesary. Results: HLA-B was found homozygous in 3 cases and heterozygous in 17 cases. Identified alleles were 07:02, 07:05, 13:01, 15:01, 15:02, 15:12, 15:25, 15:27, 15:35, 18:02, 27:06, 35:05, 38:02, 40:01, 44:03, 46:01, 55:02, 56:01, 57:01, 58:01. Conclusion: HLA typing by Sanger sequencing and cloning is accurate and cost-saving. Keywords: human leukocyte antigen (HLA), next generation sequencing (NGS), polymerase chain reaction (PCR), sanger sequencing, cloning ĐẶT VẤN ĐỀ Hệ thống phức hợp kháng nguyên bạch cầu người (HLA: Human leukocyte antigen) là hệ thống các protein trên bề mặt hầu hết các tế bào trong cơ thể, được mã hóa từ locus các gen nằm trên nhánh ngắn nhiễm sắc thể số 6, chúng đóng vai trò quan trọng trong đáp ứng *Bộ môn Sinh lý-Sinh lý bệnh-Miễn dịch – Khoa Y – ĐH Y Dược TP. Hồ Chí Minh **Trung tâm Y sinh học phân tử - ĐH Y Dược TP. Hồ Chí Minh Tác giả liên lạc: TS.BS. Đỗ Đức Minh ĐT: 0932999989 Email: ducminh@ump.edu.vn Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 4 * 2019 Hội Nghị Khoa Học Nhi Khoa BV. Nhi Đồng 1 220 miễn dịch, giúp hệ thống miễn dịch trong cơ thể phân biệt được các tế bào trong cơ thể và các tế bào ngoại lai để từ đó có thể tấn công các tế bào lạ xâm nhập(4). Các gen mã hóa cho hệ thống HLA được chia thành 3 lớp chính, trong đó chủ yếu là lớp I (HLA-A, HLA-B và HLA-C) và lớp II (HLA- DRB1 và HLA-DQB1) tham gia vào quá trình tương tác giữa mảnh ghép và kí chủ. Trên mỗi phân tử HLA đều có vùng nhận diện, cấu trúc protein của vùng nhận diện này thường khác biệt giữa các cá thể và đây là cơ sở để định típ HLA. Vùng nhận diện này được mã hóa từ exon 2, 3 của các gen HLA lớp I và exon 2 của gen HLA lớp 2. Kỹ thuật định típ HLA hiện tại ở Việt Nam vẫn dùng hai phương pháp khuếch đại DNA bằng chuỗi mồi đặc hiệu (SSP-PCR: sequence- specific primer polymerase chain reaction và SSO-PCR: sequence-specific oligonucleotide polymerase chain reaction). Hai kỹ thuật này có nguyên lý tương tự nhau và đã được phát minh vào khoảng 20 năm trước. Trong phản ứng SSP- PCR, các bộ mồi (primer) được thiết kế sẵn để nhận diện các vùng đa hình ở các locus HLA, các típ HLA sau đó sẽ được xác định bằng cách điện di sản phẩm PCR trên thạch agarose, phương pháp này chỉ cho độ phân giải của HLA ở mức 2 chữ số. Phương pháp SSO-PCR hiện đại hơn, có độ phân giải cao hơn đạt mức 4 chữ số, cũng dựa trên nền tảng thực hiện phản ứng PCR bằng bộ mồi được thiết kế sẵn, nhưng sau đó sản phẩm PCR sẽ không được phân tích trên thạch agarose mà sẽ được chuyển lên một màng lai, tại đó một bộ các phân tử đầu dò oligonucleotide có gắn chất chỉ thị sẽ được lai với sản phẩm PCR và sau đó típ HLA sẽ được xác định dựa vào các chất chỉ thị gắn trên các đầu dò. Các kỹ thuật định típ HLA này còn nhiều nhược điểm: Độ phân giải thấp (2-4 chữ số). Tốn thời gian (một lần phản ứng SSO-PCR chỉ xác định được 1 locus HLA). Không phát hiện hoặc dễ nhầm lẫn trong các trường hợp bệnh nhân mang các alen HLA hiếm, mới. Ngày càng có nhiều các alen HLA mới được phát hiện, do đó các bộ kit này cần được cập nhật liên tục. Trong khi đó, trên thế giới, việc định típ HLA dựa chủ yếu vào phương pháp xác định trình tự nucleotid bằng phương pháp Sanger hoặc giải trình tự thế hệ mới (SBT: sequence- based typing) với độ phân giải có thể chấp nhận trên lâm sàng là 4 chữ số, đây được xem là phương pháp chính xác và đáng tin cậy nhất hiện nay và là tiêu chuẩn vàng trong việc xác định HLA ở các trung tâm cấy ghép lớn(6). Do đó, thông qua nghiên cứu này, chúng tôi muốn tiến hành nghiên cứu áp dụng quy trình xác định phức hợp HLA, mà đầu tiên là locus HLA-B, bằng phương pháp giải trình tự với độ phân giải 4 chữ số nhằm khắc phục các nhược điểm của phương pháp PCR truyền thống. ĐỐI TƯỢNG - PHƯƠNG PHÁP NGHIÊN CỨU Đối tượng nghiên cứu Chúng tôi tiến hành định típ HLA locus B cho 20 người có nguồn gốc Kinh tình nguyện tham gia nghiên cứu. Phương pháp nghiên cứu Thiết kế nghiên cứu Cắt ngang mô tả hàng loạt ca. Tách chiết DNA bộ gene Tiến hành lấy 2 ml máu tĩnh mạch, cho vào ống chống đông có EDTA, lắc đều nhẹ nhàng. Genomic DNA của các tế bào bạch cầu trong máu toàn phần được tách chiết trong vòng 24 giờ bằng bộ kit GeneJetTM whole blood genomic DNA purification (Thermo Scientific, Mỹ) theo hướng dẫn sử dụng của nhà sản xuất. Phản ứng PCR khuếch đại và giải trình tự gen mục tiêu Cặp mồi được thiết kế và tổng hợp (IDT, Mỹ) dựa trên trình tự DNA của gen HLA-B mang mã số NG_023187 trong kho dữ liệu của NCBI và tham khảo từ tác giả Lazaro(3) (Bảng 1). Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 4 * 2019 Nghiên cứu Y học Hội Nghị Khoa Học Nhi Khoa BV. Nhi Đồng 1 221 Bảng 1. Cặp mồi được sử dụng để khuếch đại trình tự exon 2, 3 và vùng lân cận của gen HLA-B Tên mồi Trình tự chuỗi (5’-3’) Đoạn gen khuếch đại Tm ( 0 C) 5UT-F GACTCAGAATCTCCTCAG ACGCCGA Exon 2, 3 và vùng lân cận (1073 bp) 61,5 Bin3M13- R GGCCATCCCCGGCGACC TAT 64,5 Thiết lập điều kiện cho các PCR khuếch đại tương ứng với bộ mồi Mỗi tube PCR có thể tích 15µl chứa các thành phần: 1,5µl PCR buffer 10X; 1,5µl dNTP 2,5mM, 0,75µl cho mỗi mồi xuôi và ngược (10nM/µl), 0,1µl TaKaRa TaqTM HotStart Polymerase (Takara, Nhật Bản), 2µl genomic DNA (20-50ng/µl) và 8,4µl nước cất 2 lần khử ion. Các phản ứng luôn kèm theo một chứng âm không chứa DNA để kiểm soát ngoại nhiễm. Chu trình luân nhiệt cho PCR được thực hiện trên máy Mastercycler@Pro S (Eppendorf, Đức). Chu kỳ nhiệt: khởi đầu tại 980C trong 3 phút, tiếp theo với 40 chu kỳ lặp lại các bước 980C: 20 giây, 620C: 20 giây, 720C: 1 phút; kế tiếp với bước 720C: 2 phút. Trữ sản phẩm PCR tại 40C. Kiểm tra sản phẩm PCR bằng điện di trên gel agarose 2% và nhuộm bằng Diamond™ Nucleic Acid Dye (Promega-Mỹ). Kỹ thuật giải trình tự Bảng 2. Cặp mồi được sử dụng để giải trình tự trình tự exon 2, 3 và vùng lân cận của gen HLA-B Tên mồi Trình tự chuỗi (5’-3’) Vị trí đọc Seq-BIn2- R GGA TCT CGG ACC CGG AG Chiều ngược, exon 2 Bin3M13-R GGCCATCCCCGGCGACCTAT Chiều ngược, exon 3 Sản phẩm PCR sau đó được tinh sạch bằng Exosap-IT glycerol solution (Affymetrix-Mỹ) theo hướng dẫn sử dụng của nhà sản xuất và được thực hiện phản ứng cycle sequencing với BigDye® Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Mỹ) cặp mồi theo Bảng 2. Sản phẩm sau đó được kết tủa bằng ethanol, hòa tan trong Hi-Di formanide, biến tính ở 95C trước khi làm lạnh đột ngột. Trình tự DNA được đọc bằng máy ABI 3130 Genetic Analyzer, với POP-7 polymer và capillary 50 cm (Applied Biosystems, Mỹ). Kết quả giải trình tự DNA được phân tích bằng phần mềm CLC Main Workbench. Thực hiện chuyển gen Các mẫu sau khi giải trình tự được so với trình tự chuẩn từ kho dữ liệu của NCBI Blast server, hla.org và IMGT Blast của EBI để xác định alen HLA-B của các đối tượng tham gia nghiên cứu. Với các mẫu có các alen HLA-B dị hợp tử khó xác định, chúng tôi sử dụng phương pháp tạo dòng chuyển một alen vào vector plasmid. Sản phẩm PCR được nhân dòng trực tiếp vào vector pGEM-T dạng mạch thẳng có đầu dính T (theo bộ kit pGEM®-T Easy Vector Systems-Promega, Mỹ). Sản phẩm nhân dòng được nhiệt biến nạp vào tế bào khả biến E. coli DH5 , plasmid mang gen lacZ giúp chọn lọc những khuẩn lạc có gen chèn dựa trên sự chọn lọc màu sắc trắng/xanh của khuẩn lạc trên môi trường nuôi cấy chứa X-gal, IPTG và Ampicillin. Plasmid tái tổ hợp được tách ra từ các khuẩn lạc trắng bằng kit PureYieldTM Plasmid Miniprep System (Promega, Mỹ) và kiểm tra sự có mặt của gen HLA-B bằng PCR với các cặp mồi 5UT-F và Bin3M13-R với cùng thể tích và chu trình luân nhiệt như ở bước đầu tiên. Sản phẩm PCR từ plasmid sẽ được giải trình tự cũng bằng cặp mồi từ Bảng 2 và đọc kết quả bằng phần mềm CLC Main Workbench. Kết quả giải trình tự lần 2 sẽ có kết quả đồng hợp tử, dựa vào kết quả của 2 lần giải trình tự sẽ giúp xác định 2 alen dị hợp tử trên gen HLA-B. Thực hiện so sánh kết quả sử dụng phần mềm BLAST của EBI Phần mềm HLA BLAST của EBI là một phần mềm online miễn phí có thể truy cập vào ở địa chỉ https://www.ebi.ac.uk/ipd/imgt/hla/blast.html. Sau khi truy cập và lựa chọn chế độ so sánh cần thiết, toàn bộ trình tự DNA của exon 2 và 3 của các mẫu sẽ được nhập vào hệ thống. Ngưỡng xác định (% identities) và mức độ dương tính (% positive) của mẫu phải đạt 100% Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 4 * 2019 Hội Nghị Khoa Học Nhi Khoa BV. Nhi Đồng 1 222 mới được chấp nhận và phân típ HLA-B. Nếu vẫn chưa phân định được alen kết quả, kết quả cuối cùng sẽ được chọn dựa theo các alen HLA phổ biến và mô tả rõ (CWD: common and well-documented) của Hiệp hội Phù hợp mô và Di truyền miễn dịch Hoa Kỳ (ASHI: American Society for Histocompatibility and Immunogenetics) phiên bản 2.0.0. KẾT QUẢ Phản ứng PCR khuếch đại exon 2,3 và vùng lân cận của gen HLA-B cho sản phẩn có hình ảnh kích thước đúng với thiết kế ban đầu khi điện di trên gel agarose 1% (Hình 1). Kết quả giải trình tự 20 mẫu cho thấy có 4 mẫu đồng hợp tử sẽ được phân tích tiếp tục trên hệ thống BLAST của EBI (Hình 2), còn lại 16 mẫu dị hợp tử sẽ được tiến hành tạo dòng (Hình 3). Hình 1. Kết quả PCR khuếch đại exon 2,3 và vùng lân cận của gen HLA-B Hình 2. Kết quả HLA-B đồng hợp tử Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 4 * 2019 Nghiên cứu Y học Hội Nghị Khoa Học Nhi Khoa BV. Nhi Đồng 1 223 Hình 3. Kết quả HLA-B dị hợp tử Sau khi chuyển 1 alen HLA-B vào vector DNA và tiến hành nhiệt biến nạp vào tế bào khả biến E. coli DH5 , các tế bào khả biến sẽ được ủ nuối cấy trên môi trường thạch LB qua đêm ở nhiệt độ 370C. Các tế bào sẽ tạo khúm trên thạch LB như trên Hình 4. Chỉ có các khúm tế bào màu trắng được chọn để tiếp tục tiến hành ly trích DNA sau đó. Hình 4. Các khúm vi khuẩn xanh và trắng mọc trên thạch LB DNA ly trích từ khúm vi khuẩn màu trắng được dùng làm khuôn để thực hiện phản ứng PCR lần 2 khuếch đại đoạn gen HLA-B chèn vào vector plasmid với cặp mồi trong Bảng 1 cho kết quả phù hợp với dự đoán, băng DNA được khuếch đại có kích thước khoảng 1000bp (Hình 5). Hình 5. Sản phẩm PCR lần 2 Kết qủa giải trình tự lần 2 của các mẫu được tạo dòng đều cho sóng đơn dưới dạng đồng hợp tử (Hình 6). Phối hợp hai lần giải trình tự sẽ giúp xác định được 2 alen HLA-B di hợp tử. Kết quả các alen HLA-B trên 20 mẫu tham gia nghiên cứu được tóm tắt trong Bảng 3 với 4 mẫu cho kết quả đồng hợp tử và 16 mẫu cho kết quả dị hợp tử. Trong đó, các alen phổ biến nhất là 15:02, 46:01, 38:02 và 40:01 với tần suất lần lượt 20%, 10%, 7,5% và 7,5%. Nghiên cứu Y học Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 4 * 2019 Hội Nghị Khoa Học Nhi Khoa BV. Nhi Đồng 1 224 Hình 6. Các kết quả trình tự trước và sau khi tạo dòng Bảng 3. Kết quả định típ HLA-B của 20 đối tượng tham gia nghiên cứu TT Trạng thái Alen 1 Alen 2 %ID %Positive 1 Dị hợp tử 13:01 58:01 100 100 2 Đồng hợp tử 40:01 X 100 100 3 Đồng hợp tử 15:02 X 100 100 4 Dị hợp tử 40:01 46:01 100 100 5 Dị hợp tử 15:27 58:01 100 100 6 Dị hợp tử 46:01 56:01 100 100 7 Dị hợp tử 15:02 15:25 100 100 8 Dị hợp tử 07:05 57:01 100 100 9 Dị hợp tử 15:25 15:35 100 100 10 Dị hợp tử 15:25 38:02 100 100 11 Dị hợp tử 18:02 38:02 100 100 12 Dị hợp tử 15:02 44:03 100 100 13 Dị hợp tử 15:01 15:25 100 100 14 Dị hợp tử 15:02 35:05 100 100 15 Đồng hợp tử 46:01 X 100 100 16 Dị hợp tử 27:06 55:02 100 100 17 Dị hợp tử 15:12 44:03 100 100 18 Đồng hợp tử 15:02 X 100 100 19 Dị hợp tử 15:02 27:06 100 100 20 Dị hợp tử 07:02 38:02 100 100 BÀN LUẬN Trong nghiên cứu này, chúng tôi đã xây dựng hoàn chỉnh phương pháp định típ HLA-B bằng phương pháp giải trình tự kết hợp với tạo dòng. Các alen HLA-B được xác định trong nghiên cứu này bao gồm 07:02, 07:05, 13:01, 15:01, 15:02, 15:25, 15:27, 18:02, 27:06, 35:05, 38:02, 40:01, 44:03, 46:01, 55:02, 56:01, 57:01, 58:01 đều là các alen đã được báo cáo trong dân số người Kinh Việt Nam trước đây(1). Một số alen lần đầu mô tả là 15:12 và 15:35. Kết quả nghiên cứu này cũng cho thấy số trường hợp mang alen HLA-B đồng hợp tử khá hiếm phù hợp với tính đa hình rất cao của locus HLA-B trong nhiều chủng tộc như người Kinh Việt Nam, người Hán Trung Quốc, Nhật Bản và Thái Lan(1,2,5,7) với số liệu được so sánh trong Bảng 4. Các alen phổ biến ở người Việt Nam cũng thể hiện phần nào trong nghiên cứu này là 15:02, 46:01 và 40:01, điều này góp phần cho thấy tính tương đồng giữa người Kinh Việt Nam, người Hán Trung Quốc và người Thái khi 2 trong 3 alen phổ biến nhất của HLA-B ở cả 3 dân số đều là 46:01 và 40:01(1,5,7). Ngoài ra, nghiên cứu của chúng tôi cũng sử dụng phương pháp giải trình tự Sanger cho kết quả chính xác hơn ở độ phân giải 4 chữ số so với các phương pháp SSO-PCR truyền thống. Bảng 4. So sánh kết quả tần suất lưu hành phổ biến của các alen HLA-B giữa các nghiên cứu Dân số Việt Nam Trung Quốc Thái Lan Nhật Bản Tác giả Chúng tôi Hoa và cs (1) Shen và cs (7) Nakkam và cs (5) Ikeda và cs (2) Năm tiến hành 2018 2008 2014 2017 2014 Các alen lưu hành phổ biến Thứ tự từ tần suất lưu hành cao nhất đến thấp Tô đậm là các alen phổ biến chung trong dân số châu Á Y Học TP. Hồ Chí Minh * Phụ Bản Tập 23 * Số 4 * 2019 Nghiên cứu Y học Hội Nghị Khoa Học Nhi Khoa BV. Nhi Đồng 1 225 Dân số Việt Nam Trung Quốc Thái Lan Nhật Bản Tác giả Chúng tôi Hoa và cs (1) Shen và cs (7) Nakkam và cs (5) Ikeda và cs (2) HLA-B (%) 15:02 (20) 46:01 (10) 40:01 (7.5) 15:02 (13.5) 46:01 (11.5) 38:02 (6.5) 46:01 (14.4) 40:01 (11.7) 13:01 (8.4) 46:01 (16.8) 13:01 (9.1) 40:01 (6.9) 51:01 (8.9) 35:01 (8.2) 40:02 (7.9) Phương pháp Sanger sequencing SSO-PCR SSO-PCR SSO-PCR SSO-PCR KẾT LUẬN Định típ HLA bằng kỹ thuật giải trình tự Sanger có ưu điểm là có khả năng xác định các alen cơ bản, phổ biến, đã được mô tả rõ ở độ phân giải 4 chữ số, giá thành rẻ. Tuy nhiên, nó vẫn có điểm giới hạn là khó xác định cụ thể típ HLA độ phân giải cao hơn nếu chỉ dựa vào trình tự exon 2 và 3 mà còn cần phải có trình tự các exon và intron còn lại để có thể định típ HLA chính xác trước xu hướng ngày càng có nhiều alen mới được mô tả và đưa vào dữ liệu của IMGT. Việc tiếp tục xác định trình tự các exon và intron còn lại bằng phương pháp giải trình tự Sanger cần nhiều thời gian và công sức, vì vậy cần phải có một phương pháp có khả năng giải trình tự hàng loạt, đồng thời các exon và intron này và phương pháp giải trình tự thế hệ mới được xem như là một ứng cử viên phù hợp cho việc định típ HLA trong tương lai. TÀI LIỆU THAM KHẢO 1. Hoa BK, Hang NTL, Kashiwase K, et al (2008) HLA-A, -B, -C, - DRB1 and -DQB1 alleles and haplotypes in the Kinh population in Vietnam. Tissue Antigens, 71(2):127–134. 2. Ikeda N, Kojima H, Nishikawa M, et al (2015) Determination of HLA-A, -C, -B, -DRB1 allele and haplotype frequency in Japanese population based on family study. Tissue Antigens, 85(4):252–259. 3. Lazaro A, Tu B, Yang R, Xiao Y, Kariyawasam K, Ng J, Hurley CK (2013) Human leukocyte antigen (HLA) typing by DNA sequencing. Methods Mol Biol Clifton NJ, 1034:161–195. 4. Mosaad YM (2015) Clinical Role of Human Leukocyte Antigen in Health and Disease. Scand J Immunol, 82(4):283–306. 5. Nakkam N, Konyoung P, Kanjanawart S, Saksit N, Kongpan T, Khaeso K, Khunarkornsiri U, Dornsena A, Tassaneeyakul W, Tassaneeyakul W (2018) HLA Pharmacogenetic Markers of Drug Hypersensitivity in a Thai Population. Front Genet, doi: 10.3389/fgene.2018.00277. 6. Sanchez-Mazas A, Vidan-Jeras B, Nunes JM, et al (2012) Strategies to work with HLA data in human populations for histocompatibility, clinical transplantation, epidemiology and population genetics: HLA-NET methodological recommendations. Int J Immunogenet, 39(6):459–476. 7. Shen Y, Cao D, Li Y, et al (2014) Distribution of HLA-A, -B, and - C Alleles and HLA/KIR Combinations in Han Population in China. J Immunol Res, doi: 10.1155/2014/565296. Ngày nhận bài báo: 20/05/2019 Ngày phản biện nhận xét bài báo: 30/07/2019 Ngày bài báo được đăng: 05/09/2019

Các file đính kèm theo tài liệu này:

  • pdfdinh_tip_phuc_hop_khang_nguyen_bach_cau_nguoi_hla_human_leuk.pdf
Tài liệu liên quan