Luận văn Xây dựng quy trình định lượng cytomegalovirus (cmv) trong máu, nước tiểu bằng phương pháp real-Time pcr

Tài liệu Luận văn Xây dựng quy trình định lượng cytomegalovirus (cmv) trong máu, nước tiểu bằng phương pháp real-Time pcr: BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC SƯ PHẠM THÀNH PHỐ HỒ CHÍ MINH ----------------------------- Đặng Hồng Cúc XÂY DỰNG QUY TRÌNH ĐỊNH LƯỢNG CYTOMEGALOVIRUS (CMV) TRONG MÁU, NƯỚC TIỂU BẰNG PHƯƠNG PHÁP REAL-TIME PCR Chuyên ngành: Vi sinh vật học Mã số: 60 42 40 LUẬN VĂN THẠC SĨ SINH HỌC NGƯỜI HƯỚNG DẪN KHOA HỌC PGS. TS. CAO MINH NGA Thành phố Hồ Chí Minh - 2010 Lời cảm ơn Với lòng kính trọng và chân thành, tôi xin cảm ơn: Quý thầy, cô Khoa Sinh Trường Đại học Sư Phạm Thành phố Hồ Chí Minh đã cung cấp cho tôi những kiến thức quý báu trong suốt khóa học. Cô TS Trần Thanh Thủy, trưởng bộ môn Vi sinh vật, khoa Sinh, trường Đại học Sư Phạm TP HỒ CHÍ MINH đã luôn tạo mọi thuận lợi để tôi hoàn thành tốt luận văn này. Cô PGS. TS Cao Minh Nga, giảng viên chính bộ môn Vi sinh, khoa Y, trường Đại học Y Dược TP Hồ Chí Minh, phó trưởng khoa xét nghiệm bệnh viện Đại học Y Dược đã tận tâm hướng dẫn và giúp đỡ tôi trong suốt thời gian làm luận văn. Cử nhân...

pdf89 trang | Chia sẻ: hunglv | Ngày: 29/05/2014 | Lượt xem: 1182 | Lượt tải: 4download
Bạn đang xem nội dung tài liệu Luận văn Xây dựng quy trình định lượng cytomegalovirus (cmv) trong máu, nước tiểu bằng phương pháp real-Time pcr, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC SƯ PHẠM THÀNH PHỐ HỒ CHÍ MINH ----------------------------- Đặng Hồng Cúc XÂY DỰNG QUY TRÌNH ĐỊNH LƯỢNG CYTOMEGALOVIRUS (CMV) TRONG MÁU, NƯỚC TIỂU BẰNG PHƯƠNG PHÁP REAL-TIME PCR Chuyên ngành: Vi sinh vật học Mã số: 60 42 40 LUẬN VĂN THẠC SĨ SINH HỌC NGƯỜI HƯỚNG DẪN KHOA HỌC PGS. TS. CAO MINH NGA Thành phố Hồ Chí Minh - 2010 Lời cảm ơn Với lòng kính trọng và chân thành, tôi xin cảm ơn: Quý thầy, cô Khoa Sinh Trường Đại học Sư Phạm Thành phố Hồ Chí Minh đã cung cấp cho tôi những kiến thức quý báu trong suốt khóa học. Cô TS Trần Thanh Thủy, trưởng bộ môn Vi sinh vật, khoa Sinh, trường Đại học Sư Phạm TP HỒ CHÍ MINH đã luôn tạo mọi thuận lợi để tôi hoàn thành tốt luận văn này. Cô PGS. TS Cao Minh Nga, giảng viên chính bộ môn Vi sinh, khoa Y, trường Đại học Y Dược TP Hồ Chí Minh, phó trưởng khoa xét nghiệm bệnh viện Đại học Y Dược đã tận tâm hướng dẫn và giúp đỡ tôi trong suốt thời gian làm luận văn. Cử nhân Hồ Thị Thanh Thủy- PGĐ công ty cổ phần công nghệ Việt Á, cử nhân Nguyễn Văn Hưng- trưởng phòng dịch vụ & KCS, cùng tập thể cán bộ, công nhân viên các phòng của công ty đã tận tình giúp đỡ tôi về thực nghiệm của đề tài để tôi hoàn thành kết quả luận văn này. ThS- BS Phùng Như Toàn- Trưởng phòng tham vấn tiền sản, Th.S Bs Lê Minh Hoài An- Trưởng khoa Xét nghiệm, Bs Lê Nguyễn Bảo Trân-trưởng P.A8- phòng xét nghiệm dịch vụ, KTV Tôn Nữ Thu Trang cùng tập thể nhân viên phòng xét nghiệm bệnh viện Từ Dũ đã tạo mọi thuận lợi và cung cấp cho tôi số liệu và mẫu bệnh phẩm (nước tiểu, máu) nhiễm CMV . Dược sĩ Nguyễn Thanh Tòng- Trưởng khoa Xét nghiệm Trung tâm y khoa Medic, BS Nguyễn Bảo Toàn-phòng Sinh học phân tử và KTV Đặng Đình Triển, phòng xét nghiệm kháng thể trung tâm y khoa Medic đã cung cấp cho tôi số liệu và mẫu bệnh phẩm nhiễm CMV, HSV. Tập thể các bạn lớp cao học K18 – khoa Sinh, trường Đại học Sư Phạm TP HCM đã động viên và giúp đỡ tôi trong suốt khóa học và làm luận văn. Xin chân thành cảm ơn. Đặng Hồng Cúc DANH MỤC CÁC CHỮ VIẾT TẮT - BLAST: Basic local alignment tool - CMV: Cytomegalovirus - COBAS: COBAS AMPLICOR™ CMV MONITOR - CSF: Cerebrospinal fluid: dịch não tủy. - Da: Dalton, đơn vị đo khối lượng phân tử protein. - DNA: Deoxyribonucleic acid - dNTP: Deoxynucleoside triphosphate - dNTP: deoxynucleotie triphosphate - dUTP: deoxy Uracil triphosphate. - EDTA: Ethylene diamine tetraacetic acid. - gB: glycoproteinB - GE: genome-equivalent - IDT: Intergrated DNA Technologies - IE: immediate early: sớm tức thì - LC-PCR: LightCycler® polymerase chain reaction - PBL: Peripheral blood leucocytes: bạch cầu máu ngoại biên - PMNLs: polymorphonuclear leucocytes: bạch cầu đa nhân - Pol: polymerase. - PTLD: post-transplant lymphoproliferative disorder: rối loạn tăng sinh tế bào lympho sau ghép. - qPCR: quantitative polymerase chain reaction: PCR định lượng - UL: unique long - UNG: Uracyl – N – glycosylase - WB: whole blood: máu toàn phần. MỞ ĐẦU Nhiễm Cytomegalovirus (CMV) là loại nhiễm virus thường gặp trong cộng đồng, chiếm tỉ lệ từ 60% đến 99% người lớn trên toàn thế giới [51], nhưng hiếm khi gây ra triệu chứng lâm sàng, vì vậy chẩn đoán nhiễm CMV ít khi được quan tâm. CMV là tác nhân sinh bệnh nhiễm trùng cơ hội và nguy cơ bệnh CMV tùy thuộc sự đáp ứng miễn dịch của cơ thể. Nhiễm CMV sẽ tái kích hoạt khi bệnh nhân có hệ thống miễn dịch suy yếu, và là tác nhân gây bệnh nặng, thậm chí gây tử vong cho những người sử dụng thuốc ức chế miễn dịch, cũng như những người cấy ghép nội tạng, và đặc biệt những người nhiễm virus HIV. CMV còn là một trong những nguyên nhân gây nhiễm trùng bẩm sinh thường gặp ở thai phụ- nhiễm trùng ToRCH (Toxoplasmase, Rubella, CMV, Herpes simplex virus), gây nguy hại cho thai nhi: 0,5%-2,5% trẻ sơ sinh mắc bệnh CMV bị vàng da, lách to, giảm tiểu cầu, suy thai, nhỏ đầu, viêm võng mạc, CMV có thể để lại di chứng khốc liệt lúc mới sinh[11], [12], [13], [24], [72]. Ngoài ra, một nghiên cứu mới tại Beth Israel Deaconess Medical Center (BIDMC) xuất bản trong số ra ngày 15 tháng 5 năm 2009, cho thấy lần đầu tiên CMV, là một nguyên nhân gây ra huyết áp cao, khi kết hợp với yếu tố nguy cơ khác đối với bệnh tim, CMV có thể gây ra xơ vữa, hoặc xơ cứng động mạch [51]. Do đó, chẩn đoán sớm nhiễm CMV để đánh giá chính xác tình trạng của bệnh nhân là rất cần thiết. Đã có nhiều công trình nghiên cứu chẩn đoán nhiễm CMV như tìm kháng thể IgG-CMV, IgM-CMV, nuôi cấy virus, tìm tế bào nội mô....đều cho kết quả khả quan. Đặc biệt, cùng với sự phát triển của sinh học phân tử, người ta cũng đã sử dụng PCR định tính CMV nhưng phương pháp này khó phân biệt nhiễm tiềm tàng (nhiễm CMV không biểu hiện triệu chứng) hay nhiễm họat động (nhiễm CMV biểu hiện triệu chứng). Jiska Jebbink, và cộng sự [42] đã chỉ ra rằng nếu số lượng CMV khoảng 10.000 genomes virus /ml mẫu máu là báo trước nhiễm CMV có nguy cơ cao phát triển thành bệnh CMV. Ngoài ra còn một số công trình khác cũng chỉ ra mối tương quan giữa số lượng virus trong mẫu thử và bệnh CMV (bảng 1). Bảng 1: Minh họa các kết quả định lượng CMV tương quan bệnh CMV Tài liệu tham khảo PP định lượng Mẫu thử Số lượng gen virus/ml mẫu thử Biểu hiện triệu chứng Không biểu hiện triệu chứng Jayne C.Fos [41] năm 1995 PCR (gB) Nước tiểu 106,5 x Jayne C.Fos [41] năm1995 PCR (gB) Nước tiểu 105,2 x Lazzarotto[47] năm 2000 qcPCR (IE1) Dịch ối 105 x Gouarin [45] năm 2002 Real-Time qPCR (UL83) Dịch ối 2,8x105 x Marianne Leruez- Ville [49] năm 2003 Real-Time qPCR (UL123) Mẫu máu 3,5 log10 x Marianne Leruez- Ville [49] năm 2003 Real-Time qPCR (UL123) Mẫu máu 4,2log10 x Boppana [23] năm 2005 Real-Time qPCR (gB) Mẫu máu 1x104 x Ravit Arav-Boger [66] năm 2007 Real-Time qPCR (US17) Dịch ối 2,8x105 x Ravit AravBoger [66] năm 2007 Real-Time qPCR (US17) Dịch ối 8x103 x Vì vậy, việc định lượng CMV sẽ giúp các bác sĩ tiên lượng và có liệu pháp chữa trị sớm. Phát hiện kháng nguyên pp65 trong máu cũng giúp cho việc định lượng CMV hữu hiệu, nhanh, nhưng cũng còn nhiều nhược điểm. Trong thời gian gần đây, từ 1993 đến nay phương pháp Real-Time PCR được sử dụng nhiều ở nước ngoài [18], [26], [27] ,[28], [32], [33], [42], [46], [53], [56], [59], [70] định lượng CMV nhanh, chính xác , độ nhạy và độ đặc hiệu cao đã giúp cho sự tiên lượng những bệnh nhân nhiễm CMV có nguy cơ phát triển thành bệnh CMV để kịp thời chữa trị, đồng thời còn giúp cho việc theo dõi kiểm tra hiệu lực liệu pháp chữa trị. Tại Việt Nam cho đến nay, ở miền Nam Việt Nam, một vài nơi như công ty cổ phần công nghệ Việt Á, công ty khoa Thương, công ty Nam Khoa, bệnh viện Nhiệt Đới TP Hồ Chí Minh, bệnh viện Chợ Rẫy có kit thử định lượng CMV từ máu bệnh nhân bằng Real-Time PCR, chưa thấy công trình nào xây dựng kỹ thuật định lượng CMV từ nước tiểu bằng phương pháp Real-Time PCR. Xuất phát từ thực tiễn trên, chúng tôi tiến hành đề tài : “Xây dựng quy trình định lượng CMV trong máu và nước tiểu bằng phương pháp Real-Time PCR”. Giới hạn đề tài: Hiện nay, có bốn kiểu phản ứng được sử dụng trong kỹ thuật Real-Time PCR với độ nhạy tương đương như Molecular beacon, chất nhuộm gắn với DNA mạch đôi, probe lai, probe thủy giải (TaqMan probe). Đề tài chọn kiểu phản ứng dùng TaqMan probe, vừa đơn giản, vừa có tính đặc hiệu cao. Nhiệm vụ đề tài : - Thiết kế primers, TaqMan probe đặc hiệu định lượng CMV. - Khảo sát các điều kiện phản ứng nhằm tối ưu hóa phản ứng Real-Time PCR và xây dựng quy trình định lượng CMV trong máu và trong nước tiểu. - Ứng dụng quy trình chẩn đoán trên một số bệnh phẩm. Đối tượng và phạm vi nghiên cứu: - Những mẫu bệnh phẩm nhiễm CMV tại các phòng xét nghiệm của BV Từ Dũ, trung tâm y khoa Medic, công ty cổ phần công nghệ Việt Á. Đề tài được thực hiện tại phòng kỹ thuật của bộ môn Vi sinh, khoa Y, trường Đại học Y Dược TP. Hồ Chí Minh và công ty cổ phần công nghệ Việt Á. CHƯƠNG 1 TỔNG QUAN TÀI LIỆU 1.1. Đại cương về CMV CMV còn gọi là virus đại bào, là do tế bào bị nhiễm CMV sẽ có kích thước khổng lồ, đặc biệt bên trong nhân và bào tương lại xuất hiện nhiều thể vùi có hình mắt cú đặc trưng (hình 1.1). Hình 1.1: Tế bào bị nhiễm CMV (bên trái), và thể vùi “mắt cú” (bên phải). “Nguồn: www,pathguy,com/lectures/infect,htm” 1.1.1. Lược sử nghiên cứu về CMV [14], [50], [51], [72] - Từ năm 1881, Ribbert là người đầu tiên mô tả những tế bào kích thước khổng lồ mang thể vùi hiện diện trong thận của một em bé tử vong do giang mai. Năm 1907, phòng thí nghiệm của Ribbert tiếp tục phát hiện các thể vùi của 4 trong 30 tuyến mang tai của những đứa trẻ từ 2 tháng đến hai tuổi. Nhưng ông sai lầm khi cho rằng nguyên nhân là do động vật nguyên sinh (có tên là Entamoeba mortinatalium). Vào năm 1920, Goodpasture và Talbert là những người đầu tiên cho rằng tề bào bị phình to có thể là do hậu quả của nhiễm virus, và Goodpasture đề nghị sử dụng thuật ngữ “Cytomegalia” là để chỉ sự phồng to của tế bào bị nhiễm. Vào 1956, Smith và Rowe phân lập được CMV từ tuyến dưới hàm hoặc tuyến amidan của em bé, và CMV được gọi là: “virus của tuyến nước bọt”, hay là “virus gây bệnh thể vùi của tuyến nước bọt”. - Đến năm 1960, Weller và cộng sự đề nghị sử dụng thuật ngữ “Cytomegalovirus” bởi vì thuật ngữ “bệnh virus của tuyến nước bọt-CID (Cytomegalic inclusion disease)” khó sử dụng và sai lầm, do tuyến nước bọt chỉ là một trong nhiều vị trí bị nhiễm, Klemola và Kaarrianinen đã mô tả bệnh tăng bạch cầu đơn nhân do CMV(1965), cùng năm ấy người ta phát hiện CMV ở một bệnh nhân được ghép thận. Trong hai thập niên 1970 và 1980, sinh học phân tử của CMV được tiếp tục các nhà khoa học nghiên cứu và khám phá. 1.1.2. Phân loại CMV ở người  CMV ở người là Human Cytomegalovirus (HCMV) là thành viên của giống Herpesvirus và thuộc họ Herpesviridae, chi Betaherpesvirinae. Nhân là sợi đôi DNA. Có 8 loài virus Herpes ở người được chia làm 3 phân họ (bảng 1.1). Bảng 1.1: 8 loài virus Herpes gây bệnh ở người Phân họ TT VIRUS Bệnh liên quan Alpha- herpesvirinae 1 HSV-1 Mụn rộp ở môi 2 HSV-2 Mụn rộp ở bộ phận sinh dục, gây ung thư cổ tử cung. 3 VARICELLA-ZOSTER VIRUS (VZV) hoặc (HHV3) Bệnh thủy đậu Beta- herpesvirinae 4 EPSTEIN-BARR VIRUS (EBV_HHV4) Bệnh tăng tế bào đơn nhân, Burkitt lymphoma, ung thư dạng carcinoma vùng mũi hầu, bệnh tăng sinh tế bào lympho sau ghép (PLTD). Phân họ TT VIRUS Bệnh liên quan Beta- 5 CMV (HHV-5) Bệnh CMV herpesvirinae 6 HHV-6 Bệnh ban đào(roseola), bệnh não ghép (Transplant- encephalopathy), bệnh xơ cứng rải rác. Gamma- herpesvirinae 7 HHV-7 Bệnh ban đào (roseola) 8 HHV-8 Kaposi sarcoma, lymphoma đáy các xoang cơ thể, bệnh sarcoid. 1.2. Tình hình nhiễm CMV [3], [6], [11], [12], [13], [14], [16], [20], [23], [24], [29],[31], [50], [51], [52], [60], [71], [72] CMV là virus có mặt ở khắp nơi và thường gây nhiễm cho nhiều loài sinh vật khác nhau, nhưng cũng là tác nhân sinh bệnh thường gặp ở người. CMV gây bệnh cho người đã được ghi nhận từ thời cổ đại. Người ta tìm thấy dấu vết của nhiễm CMV trong các bộ lạc Da Đỏ cổ đại ở Nam Mỹ (ngày nay thuộc lãnh thổ Brazin). Tỷ lệ nhiễm CMV tùy thuộc vào vị trí địa lý, tình trạng kinh tế xã hội, yếu tố nuôi dưỡng và giáo dục, tỉ lệ nhiễm CMV trung bình trên thế giới là khoảng 40%. Ở Mỹ, từ 50% đến 80% số người lớn trên 40 tuổi đều nhiễm CMV, phụ nữ ở lứa tuổi sinh đẻ tỉ lệ nhiễm CMV là 60-65%, 0,7-4% phụ nữ mang thai nhiễm CMV nguyên phát, nhiễm sang thai nhi là 30- 40%, trong 40% nhiễm bẩm sinh có 10% xuất hiện triệu chứng bệnh CMV, 5-15% trong số 90% còn lại sau một vài năm có biểu hiện di chứng muộn của CMV như khiếm khuyết nghe, nhìn và chậm phát triển tinh thần. CMV gây nhiễm ở mọi lứa tuổi, tuy nhiên lứa tuổi thiếu niên là là độ tuổi thường bị nhiễm nguyên phát, và tỉ lệ nhiễm CMV tăng dần theo lứa tuổi. Theo thống kê ở Hoa kỳ với tuổi từ 6-11 tuổi là 36,3%, lớn hơn hoặc bằng 6 tuổi tỉ lệ nhiễm là 58,9%, từ 80 tuổi trở lên tỉ lệ nhiễm là 90,8%. Nhiễm CMV còn khác nhau ở các chủng tộc: 51,2% ở Tây Ban Nha không phải người da trắng, 75,8% ở Tây Ban Nha không phải người da đen, và 81,7% ở người Mỹ gốc Mexico. Mỗi năm tại Hoa Kỳ khoảng 340.000 người không phải gốc Tây Ban Nha da trắng, 130.000 người không phải gốc Tây Ban Nha da đen, và 50.000 phụ nữ Mỹ gốc Mexico bị nhiễm CMV nguyên phát. Đối với bệnh nhân AIDS, hơn 40% bị nhiễm CMV, những người cấy ghép nội tạng, nếu không có sự can thiệp kháng virus thì sẽ biểu hiện triệu chứng nhiễm CMV: 39-41% ở những người ghép tim, phổi; 9-35% ở những người ghép tim; 22-29% ở những người ghép gan và tụy; 8-32% ở những người ghép thận; 50% ở những người ghép thận và tụy; 22% ghép đoạn ruột. Ở miền Nam Việt Nam từ 16 ca ghép thận đầu tiên ở Chợ Rẫy [3] ghi nhận được số liệu ở bảng 1.2. Bảng 1.2: Tần suất nhiễm CMV ở 16 ca ghép thận Huyết thanh dương tính Người cho thận Người nhận thận IgG-CMV 12/16 13/16 IgM-CMV 3/16 2/16 Thống kê nhiễm CMV từ năm 2008 đến tháng 04/2010: + Ở bệnh viện Từ Dũ tỉ lệ mẫu xét nghiệm có kháng thể IgG-CMV là 94,26% (6013/6379), kháng thể IgM-CMV là 3,76% (240/6379). + Ở trung tâm y khoa Medic 88,59% (4896/5526) người xét nghiêm có kháng thể IgG- CMV, kháng thể IgM-CMV là 9,89% (547/5526). Xét nghiệm DNA-CMV từ 2009 đến tháng 04/2010 kết quả dương tính 30,61% ca xét nghiệm (30/98). Giá xét nghiệm một mẫu máu định lượng CMV bằng kit Roche là 750.000đ Việt Nam. 1.3. Cấu tạo của CMV [6], [14], [51] * CMV (hoặc HCMV) cũng có những đặc điểm cấu trúc đặc trưng của họ virus Herpes. Hạt virion của một HCMV từ trong ra (hình 1.2) gồm: Một bộ gen (genome) là phần lõi (core) của virus, một capsid (khoảng 162 capsomers), một chất nền (tegument) chứa enzymes, màng bọc ngoài (envelope hay membrane) và glycoprotein. Hình 1.2: Một virion của HCMV (Human Cytomegalovirus) “Nguồn :www,abbottdiagnostics,com/science, www,who,int/publications ” 1.3.1. Bộ gen CMV (hình 1.3, 1.4) là một phân tử DNA sợi đôi mạch thẳng, dài 64 nm, được chia làm hai cấu phần “duy nhất” (unique), cấu phần duy nhất dài UL (unique long), và cấu phần duy nhất ngắn US (unique short). Ở hai đầu vùng trình tự duy nhất là các vùng trình tự lặp lại đầu cuối TR (terminalrepeat sequence) và vùng trình tự đảo ngược IR (inverted repeat sequence). Vùng UL của bộ gen virus là vùng mang các gen mã hóa cho các protein quan trọng cần thiết cho sự xâm nhập và sao chép của virus như UL55 mã hóa cho glycoprtein B trên màng bọc ngoài, UL123 mã hóa cho protein IE, bộ gen của CMV còn có những vùng xác định tương đồng với một số vùng trên DNA người [6]. Đây là bộ gen có kích thước lớn nhất trong họ virus Herpesviridae, xấp xỉ 230- 240Kb (hình 1.3). Có khoảng 31% - 75% Guanin+ Cytocine. Với bộ gen > 240.000bp, có tiềm năng mã hoá protein cho hơn 200 khung đọc mở (opening reading frames) và có khả năng tổng hợp khoảng 100 protein của virus. Hiện nay, mới xác định được một vài protein từ bộ gen virus. Có những đoạn gen mã hoá quan trọng cần cho sự sao chép của virus, nhưng cũng có đoạn gen không thiết yếu, nhưng lại sản sinh ra yếu tố lây truyền từ tế bào này sang tế bào khác. Hình 1.3: Minh họa bộ gen của một số loài Herpesvirus “Nguồn: uk/335/HHV5,html” Hình1.4: Mô tả cấu trúc chi tiết bộ gen của CMV. “Nguồn:” Ghi chú: Những mũi tên màu xanh lá cây chú thích trước khung đọc mở của HCMV có khả năng mã hóa một polypeptide, mũi tên màu đỏ chỉ định khung đọc mở không mã hóa một polypeptide. 1.3.2. Bộ khung nucleocapsid (hình 1.5) - Bảo vệ bộ gen của virus. - Bộ khung capsid có hình dáng một hình đa diện 20 mặt, được cấu tạo bởi các non- phosphorylated proteins, ví dụ: p70, khung capsid có đường kính khoảng 116nm và gồm 162 capsomers. - Mỗi capsomere có đường kính khoảng 15nm, dài 20nm, có rãnh trung tâm có d=3nm. Trên bề mặt capsomere có nhiều cấu trúc nhô ra ngoài một cách đối xứng và hình dáng tua tủa như những nan hoa. Những cấu trúc này được cho là tác dụng nối kết các capsomere với nhau Hình 1.5: Capsid của herpes virus “nguồn: Linda Stannard” 1.3.3. Tegument (hình 1.6) chất nền (matrix) lấp đầy khoảng trống giữa các nucleocapsid và vỏ bọc bên ngoài (envelope), có bản chất chính là phosphorylate proteins. Trong đó glycoprotein pp65, là glycoprotein quan trọng và chiếm tỷ lệ khá lớn. Các kháng thể phản ứng với protein này cho thấy có hoạt động trung hòa virus mạnh khi có hiện diện của bổ thể và phản ứng mạnh với bề mặt của tế bào bị nhiễm. Đáp ứng kháng thể của người đối với glycoprotein pp65 chưa được nghiên cứu. Xét nghiệm tìm kháng nguyên glycoprotein pp65 trong máu là một phương pháp để phát hiện CMV và nó đóng vai trò quan trọng trong việc chẩn đoán hiện nay. Hình1.6: Chất nền matrix, và màng bọc ngoài “Nguồn: ” 1.3.4. Màng bọc ngoài của virus (envelope) (hình 1.6) - Là lớp lipit kép gồm lipoprotein và có ít nhất 33 protein cấu trúc, một vài protein cấu trúc là glycoprotein (glycosylate). - Những phân tử glycoprotein này nằm trên bề mặt và có những phần lồi ra ngoài. Phần lồi ra ngoài giúp cho virus gắn vào các thụ thể khi nó xâm nhập vào tế bào đích của túc chủ và là mục tiêu cho các kháng thể trung hoà virus. Các glycoprotein này sẽ quyết định các dòng CMV khác nhau. Các glycoprotein được biết rõ nhất trong lớp vỏ ngoài này là gp 116, gp58, gp86. glycoprotein envelope chất nền nucleocapsid - Một phát hiện cho thấy glycoprotein của vỏ bọc virus có vai trò tạo ra đáp ứng miễn dịch của cơ thể, nhưng một số khác góp phần làm giảm đáp ứng miễn dịch tế bào của túc chủ bằng cách giới hạn sự trình diện kháng nguyên của virus. 1.4. Đặc điểm của virus [9] 1.4.1. Tính bền vững CMV là virus không bền vững, dễ bị bất hoạt bởi các yếu tố như : dung môi lipit, pH<5, CMV chỉ tồn tại một giờ ở nhiệt độ 370C, 30 phút ở 500C hay 5 phút dưới tia cực tím. Bị mất khả năng gây nhiễm ở -200C - 370C, CMV có thể tồn tại ở môi trường tự nhiên bên ngoài trong nhiều giờ, có thể bảo quản CMV ở 40C trong nhiều ngày mà không mất khả năng gây nhiễm. Bảo quản CMV ở nhiệt độ -700C trong nhiều tháng không làm mất khả năng gây nhiễm. Ở nhiệt độ - 1900C, bảo quản CMV vô thời hạn. 1.4.2. Đặc tính gây bệnh của CMV (bảng 1.3) [14] - CMV là virus được giới hạn theo loài, có nghĩa là virus CMV ở người chỉ có thể nhân lên trong cơ thể con người, hay những tế bào có nguồn gốc từ con người. Trên cơ thể sống, CMV có thể gây nhiễm cho nhiều loại tế bào khác nhau như tế bào nội mô, tế bào đơn nhân, đại thực bào, tế bào biểu mô, nguyên bào sợi……CMV là virus gây bệnh cho tế bào, có nghĩa là tế bào bị nhiễm cuối cùng sẽ bị phá hủy, - CMV sống tiềm ẩn trong các dịch sinh học và các mô khác nhau của cơ thể như: nước bọt, nước tiểu, tinh dịch, sữa mẹ, phân, máu, chất tiết âm đạo và cổ tử cung, trong bạch cầu đa nhân trung tính, lympho bào T, tế bào nội mô mạch máu, biểu mô ở thận, CMV ở trạng thái thụ động, không tăng trưởng. Khi có điều kiện thuận lợi hoặc khi đáp ứng miễn dịch của cơ thể bị suy giảm virus có khả năng tái hoạt. - CMV có khả năng liên kết chặt chẽ với tế bào, do đó virus có thể lây truyền từ người này sang người khác khi tiếp xúc dịch thể nhiễm CMV, khi virus lan truyền khắp cơ thể, có nghĩa là nhiều tế bào của các cơ quan khác nhau cùng bị nhiễm. Kết quả của việc virus liên kết tế bào là hệ thống miễn dịch của cơ thể bị mất hiệu lực một cách tương đối trong việc kiểm soát virus. - CMV có khả năng gây ung thư mạnh, bằng chứng rõ nhất là sinh bệnh học của bệnh tăng sinh lympho bào sau ghép (PTLD: post transplant lymphoproliferative disease) kèm với virus Epstein-Barr. Bảng 1.3: Sơ đồ hậu quả do CMV gây ra BỆNH CMV Hậu quả gián tiếp Hậu quả trực tiếp - Là tác nhân gây ức chế miễn dịch - Hội chứng virus - Tăng nguy cơ nhiễm trùng cơ hội. - Ảnh hưởng tạng ghép - Tăng nguy cơ nhiễm nấm. - Sinh ung thư - Gây thải ghép cấp và mạn. - Giảm chất lượng sống, tăng chi phí điều trị 1.5. Quá trình xâm nhập của CMV vào tế bào [6], [14], [51], [72] 1.5.1. Đường lây truyền  Lây truyền CMV có thể xảy ra từ người này sang người khác, thông qua các sự tiếp xúc với dịch thể nhiễm CMV (nước tiểu, nước bọt, sữa mẹ, máu, nước mắt, tinh dịch, dịch tiết âm đạo v,v…) chẳng hạn như hôn, quan hệ tình dục, và dính nước bọt hay nước tiểu nhiễm CMV trên tay rồi sau đó chạm vào mắt của mình, hoặc bên trong miệng, mũi…).  CMV cũng có thể truyền qua tử cung, nhau thai, hay những mô, cơ quan ghép mà người cho bị nhiễm CMV.  Bạch cầu và tế bào CD 13+ là nơi tập trung chủ yếu của CMV. Do đó, virus cũng có thể lây nhiễm khi truyền máu. 1.5.2. Quá trình xâm nhập (hình 1.7) - Virus vào tế bào túc chủ bằng cách kết hợp và hoà lẫn vỏ của virus với màng tế bào của túc chủ hay qua hiện tượng thực bào. - Khi virus xâm nhập vào tế bào đích, sẽ có sự tham gia của tất cả các cấu trúc của virus như những phức hợp glycoprotein và các phân tử ở màng tế bào túc chủ như heparan sulphat, proteoglycan, và một loại membrane-bound protein có trọng lượng phân tử là 30-34 kD. Tác động đầu tiên của HCMV đối với tế bào túc chủ là sự hút bám: Liên kết với sulphat heparan của tế bào túc chủ qua tương tác cacbonhydrat, chủ yếu là gpUL100(gM), nhưng cũng có thể là gpUL55(gB), sau đó gắn với HLA bề mặt tế bào, tương đồng HLA(gpUL18), tương tác qua microglobulin B2 và gắn với thụ thể tế bào 32-34kD (có thể là gpUL55). - Sau khi hút bám, virus bắt đầu di chuyển xuyên qua màng tế bào. Sau đó, một loại những phản ứng sinh lý tiếp theo xảy ra trong vòng vài phút, dẫn đến hiện tượng thủy phân phosphatidylinositol(4,5)-biphosphate và kích thích quá trình chuyển hoá của axit arachidonic. Axit này sau đó được biến đổi thành prostalandin H2. Những hoá chất trung gian này được cho hoạt hoá yếu tố sao chép, yếu tố nhân kappa-B. Ngoài ra những thụ thể đôi G protein đôi cũng hoạt hoá phospholipase C, dẫn đến việc tạo ra những chất truyền tin thứ cấp inositol triphosphate và diacylglycerol. Đến lượt những chất này tiếp tục hoạt hoá giải phóng canxi từ lưới nội chất và protein kinase C. Từ đây, sự tổng hợp virus bắt đầu. Những tiểu thể của virus được tạo ra và sau đó được tập hợp lại trong nhân. Vỏ bọc của virus được tạo ra bằng cách nhô ra khỏi màng nhân bên trong của tế bào chủ. Từ đó, những tiểu thể này đi qua màng lưới Golgi và bắt đầu gây bệnh bằng cách phân tách, ly giải tạo glycoprotein B (gB), gB là sản phẩm gen UL55 của CMV và là glycoprotein vỏ của HCMV là nổi bật nhất. Hình 1.7: Chu trình sao chép của HCMV « Nguồn:www,nature,com/,,,/n8/fig_tab/nm0800_863_F1,html » Pha 1: Vỏ ngoài của HCMV nhờ glycoprotein gB và gH của virus gắn lên thụ thể tế bào túc chủ như NFk-B và SP1. Pha 2 : Capsid của vi rút vào tế bào và phóng thích DNA virus, protein và mRNA của virus tổng hợp trong bào tương, còn DNA virus vào trong nhân tế bào. Pha 3: Trong nhân, DNA của virus và gen tế bào được sao chép lại. Pha 4: DNA virus và protein của virus được đóng gói lại thành hạt virion, qua màng tế bào hình thành màng bao ngoài và lây nhiễm sang tế bào bên cạnh. Như vậy : - Chu trình phát triển của HCMV tương đối chậm, sự tổng hợp DNA virus bắt đầu trong nhân là 16-24 giờ sau khi nhiễm, không có virus nào phóng thích trong khoảng thời gian 72-96 giờ. Hiện chưa rõ vị trí nhiễm đầu tiên cũng như sự xâm nhập của virus vào dòng máu. - Khi virus vào máu, DNA của nó tìm thấy trong tế bào đơn nhân, lympho bào và bạch cầu đa nhân trung tính. Trong bạch cầu đa nhân virus không nhân lên, nhưng nó sẽ là nguồn gieo rắc virus đi khắp nơi. - Sau khi nhiễm, virus HCMV theo đường máu đi khắp nơi trong cơ thể và đến các cơ quan khác nhau như thận, gan, lách, não, võng mạc, thực quản, tai trong, phổi và đại tràng, cũng như nước tiểu và tuyến nước bọt. 1.6. Sự né tránh miễn dịch của CMV [6], [14]. Sự tương tác giữa đáp ứng miễn dịch của túc chủ và quá trình sao chép của virus quyết định khả năng gây bệnh khi nhiễm CMV, CMV có đặc tính sống âm ỉ và kéo dài. Trong giai đoạn sống tiềm ẩn virus không nhân lên trong tế bào túc chủ. Đối với nhiễm CMV mạn tính và ngay cả nhiễm CMV hoạt động thể yên lặng, cũng không có virus đang hoạt hóa. Sự tiềm ẩn virus trong tế bào đơn nhân là mối nguy hiểm bởi vì đó là nơi ẩn náu kín đáo của virus và từ đây chúng theo hệ tuần hoàn phát tán khắp cơ thể, đồng thời, tế bào đơn nhân còn duy trì virus khi nó biệt hoá thành đại thực bào. Ngoài ra, người ta còn thấy CMV có khả năng tạo ra cơ chế né tránh đáp ứng bảo vệ của cơ thể, vì vậy nhiễm CMV cũng đưa đên bội nhiễm các loại nhiễm trùng cơ hội khác như Pneumocystis carini, Aspergillus fumigatus, Candida albicans hay các loại vi khuẩn, virus khác. Đặc biệt là các virus trong họ Herpes, viêm phổi và nhiễm nấm thường xảy ra sau khi nhiễm CMV. Sự đảo ngược huyết thanh HHV-6 sau khi ghép gan có thể được xem là yếu tố báo trước cho bệnh CMV, HHV-6, bản thân nó rất hiếm gây triệu chứng lâm sàng trầm trọng, trừ khi đồng nhiễm CMV. Nếu tìm thấy DNA của HHV-6 và CMV trong nước tiểu hoặc trong huyết thanh thì đây là yếu tố chắc chắn dự đoán trước bệnh CMV sẽ xảy ra [65]. CMV còn tạo thêm một số cơ chế gây cản trở sự bảo vệ của cơ thể chủ. Một trong các cơ chế đó là giảm điều hoà sự biểu lộ các phân tử lớp I của phức hợp chủ yếu hoà hợp mô (MHC) làm cản trở sự nhận biết của các tế bào lympho T độc. Các protein của CMV người còn ức chế vận chuyển các kháng nguyên được xử lý, giữ lại các phân tử lớp I của MHC trong lưới nội nguyên sinh và tái sinh để trả lại cho bào tương các chuỗi nặng của lớp I MHC. Thiếu các phân tử lớp I MHC đáng lẽ các tế bào nhiễm CMV sẽ bị các tế bào diệt tự nhiên (NK) tiêu hủy nhưng các tế bào nhiễm CMV lại biểu lộ phân tử gpUL 18 tưong ứng với các phân tử lớp I MHC. Hơn nữa CMV còn có một kháng nguyên gpUL 40 có khả năng tăng điều hoà phân tử HLA-E thuộc lớp I không kinh điển MHC. Phân tử HLA-E ức chế tác động của tế vào NK bằng cách gắn kết với receotor lectintip C trên tế bào NK. Sau cùng CMV sản xuất một phân tử tương tự IL-10, có khả năng ức chế tổng hợp cytokin và làm mất vai trò trình diện và đồng đáp ứng miễn dịch của đại thực bào . 1.7. Những dấu hiệu nhận biết và triệu chứng bệnh CMV 1.7.1. Đặc điểm cơ bản của bệnh CMV gây ra là những thể vùi khổng lồ hình “mắt cú” trong nhân tế bào bị nhiễm (hình 1.1). 1.7.2. Triệu chứng lâm sàng 1.7.2.1. Với nhiễm CMV bẩm sinh - Trẻ sơ sinh của những người mẹ nhiễm CMV nguyên phát thường dễ đưa đến diễn tiến bệnh CMV nặng. - Trẻ sơ sinh của những bà mẹ nhiễm CMV tái hoạt hóa thường có tiên lượng tốt hơn do người mẹ đã có kháng thể trung hòa virus. Những biểu hiện trầm trọng nhất của nhiễm CMV bẩm sinh là bệnh thể vùi tế bào khổng lồ (cytomegalic inclusion disease) với một số triệu chứng phổ biến nhất bao gồm những phát hiện lâm sàng xuất huyết đốm (71%), vàng da (67%), nhỏ đầu (53%), và kích thước nhỏ với tuổi thai (50%). Bất thường trong phòng thí nghiệm thường bao gồm tăng biribulin huyết (81%), tăng mức độ của các enzym tế bào gan (83%), giảm tiểu cầu (77%), và tăng mức độ đạm CSF (77%) [71]. Nhiều đứa trẻ biến chứng nặng có thể tử vong ngay khi sinh hoặc phải nuôi trong lồng kính cách ly. Những trẻ em nhiễm trùng không có triệu chứng có thể xuất hiện các bất thường về thính giác, thị giác, phát triển tâm thần và vận động trong nhiều năm về sau. - Đặc biệt, viêm não do CMV thường gặp trong nhiễm CMV bẩm sinh. Trên mô não bị nhiễm CMV sẽ thấy có hiện tượng viêm cấp với những tế bào khổng lồ mang thể vùi phân bố trong mô dưới màng não thất và dưới màng mềm kèm theo hiện tượng hoại tử không đều rải rác trong não. Thương tổn do CMV thường khu khu trú ở não thất, não thất sinh tư và nhũng thương tổn này có thể hoá vôi. 1.7.2.2. Với nhiễm CMV mắc phải ở trẻ em - Nhiễm chu sinh và sau khi sinh - Nhiễm CMV trong thời kỳ này là do hít phải dịch tiết của cổ tử cung bị nhiễm CMV, do bú sữa mẹ hoặc có thể do truyền máu. - Nhiễm CMV thời kỳ này đặc biệt nguy hiểm vì là nhiễm nguyên phát. Nếu không có kháng thể bảo vệ trong sữa mẹ thì trẻ có nguy cơ bị nhiễm CMV trầm trọng. Thông thường ban đầu không xuất hiện gì, nhưng một thời gian sau , các triệu chứng thính giác hay những bất thường khác của não mới bắt đầu xuất hiện. - 17-41% trẻ sơ sinh bị nhiễm CMV bẩm sinh có biểu hiện viêm màng mạch võng mạc [70]. 1.7.2.3. Biểu hiện lâm sàng ở những bệnh nhân ghép tạng [3], [14]. Hội chứng nhiễm CMV trên lâm sàng xuất hiện từ tuần thứ 4 đến tuần thứ 16, cao điểm vào tuần thứ 4 đến tuần thứ 6. CMV thường kèm với tình trạng xáo trộn hệ thống miễn dịch nặng. Nguyên nhân là do giảm tỷ lệ tế bào giúp đỡ đối với tế bào ức chế và có thể gián tiếp đưa đến gia tăng tình trạng nhiễm trùng cơ hội và gây ra thải ghép. Nhiễm CMV còn tạo kháng thể kháng tế bào nội mô mà có thể đưa đến nguy cơ thải ghép cấp và thải ghép mạn. Triệu chứng sốt kéo dài 3-4 tuần là dấu hiệu nguy nhất của hội chứng CMV. Triệu chứng sốt kèm theo những dấu hiệu và triệu chứng của bệnh xâm lấn. Viêm phổi, tổn thương ống tiêu hoá, viêm túi mật, viêm thực quản, viêm gan, viêm võng mạc cũng có thể xày ra. Trong các bênh nhân ghép tạng hậu quả của bệnh CMV là giống nhau: Viêm tụy xuất hiện ở người nhận tụy, viêm phổi -xuất hiện ở những người ghép phổi hoặc ghép tim -phổi, viêm gan ở những người nhận gan ghép. Bệnh nhân ghép thận có tổn thương viêm vi cầu thận thể hình liềm và hoại tử với thể vùi bên trong vi cầu…, nhiễm CMV vẫn còn là một biến chứng có ý nghĩa sau ghép tế bào nguồn tuỷ xương. Tóm lại tạng được ghép là nơi thường dễ bị nhiễm CMV nhất. Mối liên hệ nhân quả giữa CMV và tổn thương tạng ghép vẫn còn là suy đoán và nhiều nghiên cứu cần được chứng minh cho mối liên hệ này. 1.7.2.4. Đối với bệnh nhân AIDS Nhiễm CMV gây ra nhiễm trùng đường hô hấp, tiêu hoá hoặc hệ thần kinh trung ương [9]. Nhiễm CMV xảy ra 21-44% bệnh nhân AIDS- nhất là bệnh nhân có tế bào lympho CD4 + dưới 100 tế bào/mm3 [71], tỉ lệ viêm võng mạc trên bênh nhân AIDS có nhiễm CMV là 85%. 1.8. Phòng ngừa và điều trị 1.8.1. Phòng ngừa Ngày nay các thầy thuốc lâm sàng đều quan tâm và chú trọng đến việc phòng ngừa nhiễm CMV bởi vì nếu để bệnh CMV bùng phát thì điều trị khó khăn, dự hậu xấu. Hiện nay có một số tiêu chuẩn để phòng ngừa nhiễm CMV được chấp nhận. - Tránh lây nhiễm. - Tạo miễn dịch chủ động: sử dụng vaccin Towne sẽ tạo miễn dịch dịch thể và miễn dịch qua trung gian tế bào. Vaccin không ngăn ngừa bệnh CMV hoàn toàn nhưng có khả năng làm giảm mức độ trầm trọng của nhiễm nguyên phát. - Dự phòng miễn dịch thụ động với immunoglobulin: chỉ làm giảm nguy cơ mắc bệnh chứ không ngăn được nhiễm CMV. Hiệu quả dự phòng bằng immunoglobulin có thể bị giới hạn do độ chuẩn của kháng thể không đủ. 1.8.2. Điều trị Các thuốc thường dùng là Acyclovir, Ganciclovir, Penciclovir, Valacyclovir. Tuy nhiên, Ganciclovir có hiệu quả gấp 10 lần Acyclovir trong chống CMV và virus Epstein-Barr, nó có hiệu quả như Acyclovir trong chống herpes và thủy đậu. Cidofovir có tác dụng chống một số chủng CMV kháng Ganciclovir, Fomivirsen tác dụng chống lại chủng CMV kháng Cidofovir, Foscarnet và Ganciclovir. Phân lập kháng Fomivirsen có thể nhạy cảm với Cidofovir, Foscarnet, và/hoặc Ganciclovir. Về cơ chế: Acyclovir, Cidofovir, Famciclovir, Ganciclovir, Penciclovir và Valacyclovir có tác dụng ức chế polymerase DNA của virus, Acyclovir, Cidofovir và Valacyclovir tác động lên phần cuối của chuỗi DNA. Foscarnet không cần phospho hóa trước trước khi ức chế polymerase và sao chép đảo ngược DNA của virus. 1.9. Một số phương pháp chẩn đoán [6], [14]. 1.9.1. Huyết thanh chẩn đoán tìm kháng thể kháng CMV Bao gồm các xét nghiệm tìm kháng thể kháng CMV trong máu của bệnh nhân là IgM-CMV, IgG-CMV. Xét nghiệm miễn dịch men (enzym immuno assay) phát hiện kháng thể IgG, IgM đặc hiệu giúp xác định tình trạng nhiễm CMV. Phương pháp sử dụng chủ yếu là ELISA. 1.9.2. Giải phẫu bệnh Tế bào bị nhiễm CMV sẽ to ra và đặc biệt xuất hiện thể vùi với kích thước lớn nằm trong nhân. Thể vùi có tính ái kiềm hoặc ái toan khi nhuộm bằng hematoxylin hoặc nhuộm eosin. Bao quanh thể vùi là một vòng sáng tạo thành hình ảnh giống như viên đạn chì (buckshot) hoặc mắt cú (owls eye). Kỹ thuật nhuộm miễn dịch: sử dụng cho những mẫu sinh thiết từ gan ghép, độ nhạy và độ đặc hiệu khá cao từ 84-97% [62]. 1.9.3. Các tế bào nội mô khổng lồ (Cytomegalic endothelial cell - CEC) Các tế bào được xác định bằng cách ly tâm phần tế bào đơn nhân của bạch cầu trên lam thủy tinh sau khi nhuộm đặc hiệu tế bào nội mô. Đối với người nhận tạng, CEC không thấy trong những trường hợp được điều trị dự phòng hoặc điều trị trước. Trong tương lai, xét nghiệm này trong lĩnh vực ghép tạng sẽ được áp dụng rộng rãi. 1.9.4. Phân lập virus Là phương pháp thông thường và cổ điển nhất cho kết quả lâu (1-2 tuần), 1.9.5. Xét nghiệm tìm kháng nguyên trong máu (antigenemia assay) Là phương pháp tiến bộ đáng kể trong chẩn đoán nhiễm CMV ở những người được ghép tạng. Các tế bào nhiễm CMV được xác định bằng các kháng thể đơn dòng kháng lại các protein đặc hiệu của virus (ví dụ pp65). Đây là kỹ thuật đặc hiệu, độ nhạy cao và thông dụng nhất trong việc xác định nhiễm virus trong máu. 1.9.6. Kỹ thuật lai tại chỗ (in situ hybridization- ISH) Lai tại chỗ là lai phân tử mà trong đó một axit nucleic chuỗi đơn đã biết được gắn với chất phóng xạ hoặc huỳnh quang. Đem phân tử này đặt vào các tế bào hay mảnh mô đã được chuẩn bị và quá trình tác dụng (lai) sẽ xảy ra tại chỗ để tạo thành nhiều phân tử chuỗi kép. Nghiên cứu ISH có thể sử dụng khi kết quả chẩn đoán mô- bệnh học còn nghi ngờ. Ứng dụng này dùng trong chẩn đoán viêm phổi, viêm gan, viêm dạ dày ruột do CMV. Kỹ thuật thực hiện còn cồng kềnh. 1.9.7. Kỹ thuật PCR (Polymerase chain reaction) xác định DNA của virus PCR (polymerase chain reaction – phản ứng trùng hợp chuỗi): năm 1985, Kary B, Mullis cùng các cộng sự đã phát minh ra phương pháp PCR. Đây là một kĩ thuật phân tử tạo dòng DNA rất đơn giản và hiệu quả. Thông qua PCR, hàng triệu đoạn DNA đồng nhất có thể được thu thập một cách dễ dàng từ một hỗn hợp các phân tử bao gồm RNA, protein, polysaccharide, DNA không có chức năng và DNA có chức năng di truyền. Người ta còn gọi nó là kĩ thuật tạo dòng DNA in vitro. Ngày nay, PCR được dùng rất phổ biến trong lĩnh vực sinh học. PCR cho phép chẩn đoán nhanh nhiễm CMV, nhưng nếu kết quả dương tính cũng không cho ta xác định được là virus mới nhiễm hay là nhiễm tiềm ẩn. Real-Time PCR là một cải biên của phương pháp PCR dùng để định lượng có thể xác định chính xác số lượng của CMV trong cơ thể, thậm chí ở những vị trí đặc hiệu. Kỹ thuật PCR có thể phát hiện được CMV-DNA trong bạch cầu ở máu ngoại vi và toàn bộ máu cũng như CMV-RNA trong bạch cầu. Mặc dù CMV kết hợp với tế bào, CMV-DNA cũng có thể được phát hiện trong các dịch tự do của cơ thể. Định lượng PCR là một phương pháp tốt nhất trong việc chẩn đoán CMV hiện nay. 1.10. Khái niệm về Real-Time PCR [1], [2], [4], [7], [10], [15], [22], [57], [64], [68]. 1.10.1. Khái niệm: Real-Time PCR không những định tính mà còn định lượng, Real-Time PCR là một cải biên của phương pháp PCR dùng để định lượng một lượng nguyên liệu ban đầu nhỏ. 1.10.2. Nguyên tắc: Real-Time PCR cho phép phát hiện và định lượng sự tích lũy DNA khuyếch đại ngay khi phản ứng đang xảy ra, đó là ý nghĩa cụm từ “Real time” – thời gian thực. Khả năng này được thực hiện nhờ bổ sung vào phản ứng những phân tử phát huỳnh quang (fluorescent dye) báo hiệu sự gia tăng lượng DNA tỷ lệ với sự gia tăng tín hiệu huỳnh quang, Real-Time PCR dùng để định lượng được gọi là PCR định lượng (qPCR). Tín hiệu huỳnh quang được đo lường phản ánh sản phẩm khuyếch đại trong mỗi chu kỳ. 1.10.3. Ưu điểm  Ưu điểm chính của Real-Time PCR so với PCR truyền thống là nó cho phép xác định số lượng bản sao khuôn mẫu ban đầu với sự chính xác và độ nhạy cao trong một phạm vi biến thiên rộng.  Dữ liệu Real-Time PCR có thể được đánh giá mà không cần phải điện di trên gel, giúp tiết kiệm thời gian và gia tăng số lượng thí nghiệm thực hiện.  Việc tiến hành phản ứng và đánh giá dữ liệu trong một hệ thống ống đóng kín giúp làm giảm nguy cơ ngọai nhiễm và lọai bỏ những thao tác sau phản ứng. 1.10.4. Phân loại: Hiện nay có bốn phương pháp định lượng sản phẩm khuếch đại nhờ probe có gắn chất phát huỳnh quang [2]. 1.10.4.1. Molecular beacon: loại probe này có cấu trúc dạng vòng và cuống. Phần cấu trúc dạng vòng sẽ bắt cặp bổ sung đặc hiệu với trình tự DNA mục tiêu, còn phần cấu trúc dạng cuống được tạo thành từ các base nằm ở hai đầu mút của probe bắt cặp bổ sung với nhau nhờ liên kết hydro. Một đầu probe sẽ được gắn một chất hóa học phát huỳnh quang, đầu kia được gắn một chất hóa học khác có nhiệm vụ ˝dập tắt˝ (quencher) Molecular beacon có tính đặc hiệu rất cao. Việc thiết kế probe dạng beacon rất khó và quan trọng (hình 1.8). Hình1.8: Quá trình phát tín hiệu huỳnh quang của Molecular beacon 1.10.4.2. Chất nhuộm gắn với DNA mạch đôi: chất nhuộm này gắn với mọi phân tử DNA mạch đôi và chỉ phát tín hiệu huỳnh quang khi gắn vào chúng. Hai chất nhuộm phát huỳnh quang thường được sử dụng là SYBR Green I và Ethidium bromide. Nhược điểm của phương pháp này phản ứng sẽ cho kết quả định lượng không chính xác nếu có sản phẩm ký sinh (hình 1.9). Hình1.9 : Cơ chế phát huỳnh quang của chất nhuộm SYBR Green I 1.10.4.3. Probe đôi (Hybridization probe): phương pháp này có độ đặc hiệu rất cao do việc sử dụng cùng lúc hai probe bắt cặp với trình tự DNA mục tiêu. Một probe sẽ gắn chất cho huỳnh quang (fluorescein donor) ở đầu 3’ phát ánh sáng xanh, một probe sẽ gắn chất nhận huỳnh quang (fluorescein accepter) ở đầu 5’và luôn chặn ở đầu 3’ DNA sao cho Taq polymerase không thể kéo dài mạch từ đầu này. Ưu điểm của phương pháp này là việc thiết kế probe tương đối linh động, dễ dàng hơn so với việc thiết kế beacon (hình 1.10). Chất phát huỳnh quang Quencher Phát tín hiệu huỳnh quang Hình1.10 : Cơ chế phát tín hiệu huỳnh quang của probe đôi. 1.10.4.3. Probe thủy giải (Hydrolysis probe): còn được gọi là TaqMan probe, probe này được gắn một chất phát huỳnh quang ở đầu 5’ và một chất “dập tắt” huỳnh quang (Quencher) ở đầu 3’ sao cho ánh sáng huỳnh quang phát ra bị hấp thu bởi quencher. Trong phản ứng PCR, probe này sẽ bắt cặp bổ sung đặc hiệu với trình tự DNA mục tiêu, khi Taq polymerase kéo dài mạch bổ sung từ đầu 3’ của primer đến tiếp xúc với probe, nó sẽ thể hiện hoạt tính 5’–3’ exonuclease là loại bỏ các nucleotide ở đầu của probe và thay bằng nucleotide mới, lúc đó, chất phát huỳnh quang sẽ tách rời khỏi probe và phát tín hiệu, còn quencher bị mất tác dụng dập tắt. TaqMan probe có tính đặc hiệu cao, chỉ bắt cặp và phát tín hiệu nếu trình tự bổ sung với mạch khuôn là hoàn toàn, vì vậy các sản phẩm ký sinh nếu có cũng không được phát hiện (hình 1.11). Hình1.11 : Phương pháp TaqMan probe 1.10.5. Một số thuật ngữ khác 1.10.5.1. Chu kỳ ngưỡng (threshold cycle-Ct) [2] Là khái niệm trung tâm của kỹ thuật Real–Time PCR. Nguyên tắc định lượng của kỹ thuật này là dựa vào một đường cong chuẩn (standar curve) được xây dựng từ các giá trị chu kỳ ngưỡng của các mẫu đã biết trước nồng độ DNA. Chu kỳ ngưỡng của một mẫu là chu kỳ mà tại đó tín hiệu huỳnh quang mẫu vượt lên tín hiệu huỳnh quang nền của phản ứng PCR và được các thiết bị cảm biến ghi nhận. Tín hiệu huỳnh quang nền do các chất phát huỳnh quang có nồng độ xác định có sẵn trong thành phần phản ứng PCR, nhưng đối với phản ứng Real–Time PCR sử dụng TaqMan probe, thì chính quencher sẽ tạo tín hiệu nền cho phản ứng. Các mẫu có nồng độ DNA ban đầu lớn sẽ có Ct nhỏ và ngược lại [1] (hình 1.12). Hình1.12: Mô tả chu kỳ ngưỡng 1.10.5.2. Đường cong chuẩn (Standar curve) [1], [2], [46]. Là đường biểu diễn vẽ lên mối quan hệ giữa chu kỳ ngưỡng với số lượng bản DNA đích ban đầu có trong các mẫu chuẩn. Đây là một đường thẳng tuyến tính đi qua các điểm tọa độ xác định bởi số lượng bản DNA đích ban đầu của từng mẫu chuẩn (trên biểu đồ chuẩn trục tung là chu kỳ ngưỡng, còn trục hoành là số lượng bản DNA đích ban đầu có trong mẫu chuẩn). Các thiết bị phản ứng Real-Time PCR sẽ tự động xây dựng một đường cong chuẩn dựa trên chu kỳ ngưỡng của các mẫu chuẩn biết trước nồng độ. Phương trình hồi quy và giá trị r sẽ được trình bày phía trên đồ thị. Qua đó, chúng ta đọc được hiệu quả khuyếch đại và đường chuẩn tuyến tính R2. Một phản ứng PCR định lượng tối ưu sẽ có hiệu quả khuyếch đại (E) cao 90-105% và đường chuẩn tuyến tính R2>0,980. Hình 1.13:. Kết quả các mẫu chuẩn từ 101-106 copies Hình1.14: Mô tả đường cong chuẩn [46]. Ghi chú: hình 1.14 cho ta R2 (Correlation Coefficient)=1, hiệu quả khuyếch đại (PCR Efficiency) E=96,2%. CHƯƠNG 2 VẬT LIỆU VÀ PHƯƠNG PHÁP 2.1. Mẫu bệnh phẩm Mẫu máu, mẫu nước tiểu của những người nghi ngờ nhiễm CMV đã được xác định dương tính bằng phương pháp tìm kháng thề IgG, IgM ở bệnh viện Từ Dũ, trung tâm y khoa Medic, và xác định bằng PCR tại Công ty cổ phần công nghệ Việt Á. Mẫu HSV1, HSV2 cung cấp từ trung tâm y khoa Medic đươc khẳng định dương tính bằng phương pháp miễn dịch kháng thể. Mẫu huyết thanh khẳng định có chứa HBV, HCV, HPV, EBV, MTB được xác định dương tính bằng Real-Time PCR ở công ty cổ phần công nghệ Việt Á. 2.2. Vật liệu 2.2.1. Các thiết bị dụng cụ [2] Gồm các thiết bị cơ bản (xem phụ lục): - Ống eppendorf 0,2ml, 1,5ml - Pipetman1000l, 200l, 100l, 10l và các đầu tip tương ứng - Ống nghiệm, ống hút, becher, đĩa petri, giá đỡ ống nghiệm. - Máy ủ nhiệt, máy ly tâm siêu tốc, máy Real-Time PCR, máy vortex, máy vi tính các phần mềm chuyên dụng để thiết kế và đánh giá primer, thiết kế phản ứng PCR, tủ cấy vô trùng, tủ lạnh, tủ hút khí độc, bàn đèn tử ngọai… Vật liệu tiêu hao: găng tay không phấn, đầu tip có phin lọc…. 2.2.2. Hóa chất [2] 2.2.2.1. Hóa chất dùng tách chiết DNA + Proteinase K + Dung dịch 1: triozol (phenol 38%, guanidium thyocinate 0,8M, glycerol5%), chỉnh pH=8. + Dung dịch 2: chloroform. + Dung dịch 3: izopropanol tuyệt đối có chứa chất trợ tủa. + Dung dịch 4: ethanol 70%. + Dung dịch 5:dung dịchTE 1X (tris 0,1M-EDTA 0,001M). 2.2.2.2. Hóa chất dùng trong Real-Time PCR + DNA-CMV được tách chiết bằng phenol chloroform + Primer (mồi) xuôi, primer ngược, TaqMan probe đã được công ty IDT (Intergrated DNA Technologies) của Mỹ thiết kế. + PCR master mix (Pha PCR mix cho Real-Time PCR dùng TaqMan probe): Thể tích hỗn hợp phản ứng là 25 µl bao gồm: 1. PCR buffer 1X- 2. 1,5 unit Taq DNA polymerase có họat tính 5’-3’ exonuclease 3. dNTP=400µM/L/ mỗi loại dATP, dGTP, dCTP và dTTP 4. 10-25pm primer xuôi, primer ngược 5. 2-5pm TaqMan probe 6. 3-5mM MgCl2 7. Thêm dUTP, hoặc UNG giảm khả năng ngoai nhiễm 2.3. Phương pháp [1], [4], [8], [10], [15], [22], [57], [64], [68]. 2.3.1. Thiết kế hệ primers (mồi) và TaqMan probe Trong đề tài này chúng tôi thực hiện phương pháp Real-Time PCR kiểu phản ứng sử dụng TaqMan probe. Các bước để phát triển một phản ứng TaqMan probe là 1. Thiết kế primers và TaqMan probe. 2. Đánh giá tính hiệu quả và tối ưu hóa phản ứng. Để thiết kế hệ primers và probe có nhiều phần mềm dùng để thiết kế và chúng tôi sử dụng các phần mềm sau:  Clustal X 2.0  Annhyb 4.922 năm 2004 (Olivier Friard, Hoa Kỳ)  Phần mềm trực tuyến BLAST ( NCBI) ww.ncbi.nlm.nih,gov/BLAST/  Phần mềm trực tuyến Oligo Analyzer 3,0 (IDT, Hoa Kỳ) www.scitool.,id.,com/scitools/Applications/OligoAnalyzer/ Một phản ứng Real-Time PCR thành công đòi hỏi sản phẩm phải được khuyếch đại (trình tự đích) đặc hiệu và hiệu quả. Thiết kế primer phù hợp với trình tự đích là rất quan trọng, vì vậy, việc chọn trình tự đích (sản phẩm khuyếch đại) cần tiến hành trước. 2.3.1.1. Chọn sản phẩm khuyếch đại A- Nguyên tắc: - Sản phẩm khuyếch đại từ 75-200bp. Trình tự càng ngắn thì hiệu quả khuyếch đại càng cao. Tuy nhiên chúng phải dài hơn 75 bp để có thể dễ dàng phân biệt với các trình tự primer- dimer có thể đựơc tạo ra. - Cần tránh cấu trúc thứ cấp ở nhiệt độ bắt cặp hay không, (kiểm tra bằng cách sử dụng chương trình mfold: applications/ mfold/, hoặc xem tập san Bio- Rad 2593). - Tránh một base đơn được lặp lại hơn 4 lần liên tục trên khuôn DNA - Duy trì hàm lượng G, C ở 50-60%. * Sản phẩm khuyếch đại được chọn là một đoạn trình tự gen UL123 (CMV), mã hóa protein 72KDa B- Cách tiến hành - Đầu tiên tải tất cả trình tự nucleotide của gen UL 123(CMV) từ ngân hàng dữ liệu gen NCBI (National Center for Biology Information) trên internet www,ncbi,nlm,gov và lưu lại trong unitled-notepad. - Sau đó so hàng (alignment) các trình tự tải về bằng phần mềm ClustalX 2.0. ClustalX là một phần mềm (giao diện Windows) dùng để so sánh tương đồng nhiều trình tự DNA hay trình tự protein. Nó mô tả kết quả bằng hệ thống các màu sắc và làm nổi bật những nét đặc trưng trong những đoạn tương đồng.  Cách sử dụng chương trình ClustalX2.0 Để nhập dữ liệu cho chương trình ClustalX, thực hiện các bước sau:  Mở chương trình ClustalX trên Desktop  Lựa chọn chức năng Multiple Alignment Mode  Từ Menu File, chọn Load Sequences  Trong hộp Open, chọn tập tin chứa các trình tự cần so sánh, nhấn nút Open. Hình 2.1: Nhập trình tự cho chương trình ClustalX Sau khi chọn open ta được bảng gióng cột. Hình 2.2: Kích hoạt open sắp gióng cột trong chương trình ClustalX Để thực hiện sắp gióng cột các trình tự nhập vào, chúng ta chọn Do complete alignment trong menu Alignment. Xác định vị trí cho file lưu rồi nhấn nút OK. Kết quả xuất hiện các trình tự so sánh tương đồng. Các vị trí nucleotide hay amino acid giống nhau sẽ được thể hiện cùng một màu sắc, mỗi loại một màu, và được đánh dấu *. Ta có thể biết được độ tương đồng của các trình tự thông qua sự tương đồng về màu sắc và chọn đoạn tương đồng cao làm trình tự đích. Hình 2.3: Thể hiện kết quả sắp gióng cột trong chương trình ClustalX 2.3.1.2. Thiết kế hệ primers và TaqMan probe  Thiết kế primer: đây là một trong những yếu tố quan trọng nhất trong phản ứng PCR, có vai trò làm primer cho hoạt động kéo dài mạch của DNA polymerase. Do đó, việc thiết kế primer phải được tiến hành thật chính xác, tránh ảnh hưởng đến hiệu quả và độ chuyên biệt của phản ứng PCR. Nguyên tắc thiết kế primer: - Hàm lương GC từ 50-60%. - Nhiệt độ nóng chảy (Tm) từ 50-65 0C. Giá trị Tm được tính bằng phương pháp lân cận gần nhất với giá trị của 50mM nồng độ muối và 300nM nồng độ oligonucleotide. - Tránh cấu trúc thứ cấp. - Tránh lặp lại base G, C hơn 3 lần. - Thiết kế base G và C ở đầu và cuối primer. Thành phần 5 nucleotide cuối cùng ở đầu 3’ không nên có hơn 2G hoặc C nhằm tránh hiện tượng nhân bản ký sinh trong phản ứng PCR. - Kiểm tra trình tự của primer xuôi và ngược để đảm bảo không có sự bắt cặp ở đầu 3’( tránh tạo ra primer-dimer). - Kiểm tra sự đặc hiệu bằng những công cụ như Basic Local Alignment Search Tool (  Thiết kế TaqMan probe: Nguyên tắc thiết kế TaqMan probe: - TaqMan probe có nhiệt độ nóng chảy cao hơn primer 5-100C (vì ở giai đọan 600C là nhiệt độ bắt cặp tối ưu của TaqMan probe, TaqMan probe sẽ bắt cặp vào sợi đích trước, rồi primer mới bắt cặp) . - Ngắn hơn 30 nucleotide và không có base lọai G ở đầu 5’ bởi vì nó có thể hấp thụ tín hiệu hùynh quang ngay cả khi TaqMan probe bị cắt đứt. - Trình tự TaqMan probe cần có hàm lượng GC từ 30-80% và TaqMan probe phải có nhiều base C hơn base G. - Vị trí bắt cặp ở đầu 5’ của TaqMan probe nhưng không kéo dài đầu 3’ của primer, cách vị trí 3’ của primer bắt cặp trên cùng sợi đích khoảng 2-5 base. - Quan trọng là lựa chọn chất phát và chất hấp thụ hùynh quang . Đề tài chọn kiểu phản ứng singleplex, cho nên probe sẽ chọn chất FAM (6- carboxyfluorescin) làm chất phát huỳnh quang, và TAMRA (6-carboxytetra-methylrhodamine) làm chất hấp thụ huỳnh quang vì giá thành thấp, có sẵn, hiệu quả tốt và tín hiệu có thể phát ra bởi bất kỳ thiết bị nào hiện có.  Cách tiến hành thiết kế hệ primers và TaqMan probe  Cách sử dụng phần mềm ClustalX Sau khi chạy ClustalX các đoạn gene UL123 tải về, so sánh trình tự và xác định vùng bảo tồn (vùng có các trình tự tương đồng của tất cả các đoạn gene), và dựa vào các cặp primer và TaqMan probe đã được công bố trên các bài báo uy tín quốc tế [26], [42], [48], [56], [58], [69] để chọn primer và TaqMan probe, chạy ClustalX các đoạn gene UL123 với từng primer xuôi, primer ngược và TaqMan probe, đánh giá mức độ tương đồng của các đoạn trên.  Mở chương trình ClustalX đã gióng cột.  Vào file/ append sequenses/ trong hộp append khai báo file primer/open. Hình 2.4: Minh họa cách gióng cột primer trong ClustalX  Ta được: Hình 2.5: Primer được nối vào cột ClustalX  Tiếp tục vào menu alignment/ Do complete alignment/ khai báo địa chỉ lưu/OK ta được kết quả sắp gióng cột primer xuôi, primer ngược, và TaqMan probe (mẫu dò) (hình 3.1, hình 3.2, hình 3.3).  Cách sử dụng phần mềm Blast Sau bước đánh giá mức độ tương đồng của các đoạn trên, ta phân tích và đánh giá hệ primers, probe về Tm, %GC, hairpin (kẹp tóc), self–dimer, hetero– dimer, độ tương đồng, kích thước sản phẩm PCR tạo thành bằng các chương trình BLAST, Annhyb4-922, Oligo Analyzer 3,0 của IDT ( analyzer/oligocal,asp). Vào  Chọn nucleotide blast  Trong vùng : Choose Search Set, dòng database : chọn nucleotide colletion  Trong vùng : Program Selection, chọn Optimize for Somewhat similar sequences (blastn).  Coppy cấu trúc primer vào vùng Enter Query Sequence, và click nút blast, kết quả tương đồng giữa primer và probe giúp ta xác định độ đặc hiệu của primer và probe được thiết kế so với gen CMV.  Cách sử dụng phần mềm Annhyb 4.942 AnnHyb 4.942 (Annealing and Hybridization) là phần mềm miễn phí dùng để phân tích trình tự nucleotide với các đặc trưng như chuyển đổi qua lại giữa các định dạng trình tự, dịch mã, phân tích bảng đồ cắt giới hạn, tìm motif, khung đọc mở. Mở phần mềm Annhyb 4.942  Vào Menu Oligo, chọn New Oligo  Phần Name: Nhập tên đoạn Oligo vào  Note: Chọn màu đoạn primer, hoặc TaqMan probe  Seq, 5’: Nhập trình tự primer hoặc TaqMan probe vào  Ta vào Menu Oligo, chọn Align Oligo with Sequences. Ta có kết quả Align của primer và trình tự.  Cách sử dụng Oligo Analyzer 3.0 của IDT  Vào  Vùng : Sequence nhập trình tự mối và probe theo chiều 5’- 3’,  Để kiểm tra cấu trúc thứ cấp nào thì ta chọn vùng đó, sau đó click nút submit  Để kiểm tra đặc tính ta chọn analyze. Từ đó chọn cặp primers, TaqMan probe tốt nhất để chạy phản ứng Real - Time PCR. Gởi công ty IDT (Intergrated DNA Technologies) của Mỹ thiết kế. 2.3.2. Phương pháp tách chiết DNA –CMV Có thể tách chiết DNA-CMV từ nhiều dịch sinh học khác nhau như máu, nước tiểu, hoặc dịch sinh học khác. Và cũng có nhiều phương pháp khác khau để tách chiết DNA như phương pháp BOOM, CTAB, hoặc phenol-chloroform. Mỗi phương pháp sẽ có một nguyên tắc riêng, nhưng nguyên tắc chung là: 1. Phá vỡ tế bào, màng và phân hủy protein để giải phóng DNA. 2. Xử lý bằng nhiệt để phá hủy hoàn toàn protein, giải phóng DNA ra khỏi nhân. 3. Tách DNA ra khỏi đệm tách và bào quản DNA ở 4 đến 200C. Riêng đề tài này chúng tôi chọn phương pháp tách chiết bằng phenol chloroform [2]. Nguyên tắc: mẫu bệnh phẩm khi trộn với dung dịch phenol /chloroform /Izoamyl alcohol(P/C/I=25:24:1) thì các protein trong mẫu sẽ bị phenol làm biến tính và vón cục lại. Khi ly tâm, nhờ có sự hiện diện của chloroform, các vón cục sẽ bị tách ra và tập trung trong lớp phân cách giữa nước và P/C/I (Chloroform thường đi kèm với phenol có tác dụng bổ sung và làm mất hoàn toàn dấu vết của phenol, Chloroform cũng làm biến tính protein nhưng yếu hơn phenol). Pha nước chứa DNA sẽ được lấy ra và làm kết tủa trong izopropanol có bổ sung chất trợ tủa (chất trợ tủa có tác dụng bắt các phân tử DNA, nhưng không ức chế phản ứng PCR). Khi thực hiện với sự có mặt của chất trợ tủa, quá trình tủa có thể xảy ra ở nhiệt độ phòng với thời gian ngắn (10 phút). Trong điều kiện không có chất trợ tủa, quá trình tủa phải thực hiện ở - 200C trong ít nhất 1 giờ. DNA sau khi được tủa sẽ rửa lại 1 lần với ethanol 70% và cuối cùng được bảo quản trong TE1X (T: Tris có vai trò ổn định pH và E: EDTA bắt các ion Mg2+ làm cho DNase không hoạt động). 2.3.2.1. Quy trình xử lý nước tiểu và tách chiết DNA trong nước tiểu [17], [18], [19], [25], [26], [34],[35], [37], [40], [43], [44], [61]. Phương pháp này sử dụng proteinase K để thủy giải toàn bộ proteine có trong mẫu nước tiểu. Bước 1: Lấy 6 ml nước tiểu cho vào fancol 15ml, ly tâm tốc độ 4000v/p trong 30phút Bước 2: Đổ bỏ dịch nổi, thu cặn và cho vào 200µl TE1X (0,1M NaCl, 10 mM Tris-HCl, 1mM EDTA- pH=8,0) +0,1% SDS và 40µg proteinase K, ủ ở 370C trong 3 giờ, tốt nhất là ủ qua đêm. Sau đó có thể đun nóng mẫu ở 1000C trong vài phút để bất hoạt proteinase K còn lại. Mẫu thử lúc này có thể sẵn sàng để tách chiết DNA. Bước 3: Lấy 200 µl mẫu tiến hành tách chiết DNA bằng tủa phenol : cloroform: isoamylalcool (25:24:1) giống quy trình tách chiết DNA trong huyết thanh. 2.3.2.2. Quy trình tách chiết DNA trong máu hoặc huyết thanh, nước tiểu (hình 2.6): Bước 1: Đánh dấu các tube 1,5ml vô trùng bằng ký hiệu mẫu. Bước 2: Cho 200l mẫu vào 1 tube vô trùng có sẵn 900l dung dịch 1 (triozol), vortex 30s, để yên 10 phút, thêm vào 200l dung dịch 2 (chloroform), trộn đều, để yên 10 phút. Ly tâm 13000 vòng /phút trong 10 phút. Bước 3: Thu 600l dung dịch nổi có chứa DNA (chỉ thu dịch nổi) vào 1 tube vô trùng khác có sẵn 600l dung dịch 3 (izopropanol) (trộn đều dd3 trước khi sử dụng). Trộn đều dịch trong tube, để yên trong tủ lạnh 10 phút. Ly tâm 13000 vòng/phút trong 10 phút. Bước 4: Loại bỏ dịch nổi, thu cặn màu xanh ( tránh loại bỏ luôn phần cặn), cho từ từ 900l dung dịch 4 (ethanol) vào, ly tâm 13000 vòng/phút trong 5 phút. Bước 5: Thu cặn màu xanh, để khô ở 600C trong 10-15 phút, cho 50l dung dịch 5 (TE 1X) vào và đặt phản ứng. Bước 6: Nếu chưa đặt phản ứng phải bảo quản mẫu ở -200C. Mẫu QUY TRÌNH TÁCH CHIẾT DNA/RNA Vào eppendorf chứa 900 µl dung dịch 1 Ly tâm 13.000 vòng/phút, 10 phút Hút 200 µl µl mẫu (Mẫu bệnh lao hút 100 µl) Vortex Trộn đều Thêm vào 200 µl dung dịch 2 Hút 600 µl dung dịch nổ i vào eppendorf có sẵn 600 µl dung dịch 3 Làm lạnh 10 phút Ly tâm 13.000 vòng/phút, 10 phút Để yên 10 phút Đổ dung dịch nổi Thu cặn màu xanh Thêm vào 900 µl dung dịch 4 Ly tâm 13.000 vòng/phút, 5 phút Đổ dung dịch nổi thu cặn màu xanh Thấm vào giấy cho ráo Sấy khô ở 60 oC Cho vào 50 µl dung dịch TE 1X Mẫu lao cho vào 100 µl dung dịch TE 1X Bảo quản lạnh -20 oC Mẫu RNA cho vào 50 µl dung dịch DEPC Hình 2.6: Quy trình tách chiết DNA trong huyết thanh (xem thêm phụ lục) 2. 3.3. Phương pháp Real-Time PCR Phản ứng Real-Time PCR sử dụng TaqMan probe được thiết lập với 5 µl DNA-CMV với 20 µl master mix pha từ iTaq DNA Polymerase (Bio-Rad), phản ứng Real-Time PCR sử dụng PCR Amp/Cycle Graph với FAM-490. Chương trình luân nhiệt được tiến hành như sau: 1 Chu kỳ 95,0ºC 15 phút 40 Chu kỳ 95,0ºC 15 giây 57,0ºC 1 phút 72,0ºC 20 giây Việc phân tích kết quả sau phản ứng luân nhiệt được thực hiện với phần mềm iCycler (Bio- rad) theo đúng hướng dẫn sử dụng. 2.3.4. Phương pháp khảo sát tối ưu hóa điều kiện phản ứng Real-Time PCR [1], [15]. 2.3.4.1. Khảo sát nhiệt độ lai: Nhiệt độ lai là một chỉ tiêu quan trọng ảnh hưởng lớn đến kết quả của phản ứng PCR. Nhiệt độ lai quá cao hay quá thấp đều ảnh hưởng không tốt đến hiệu quả nhân bản của phản ứng PCR. Nhiệt độ lai quá thấp so với nhiệt độ biến tính của cặp primer sử dụng dễ tạo nên các sản phẩm ký sinh không mong muốn trong phản ứng, còn nhiệt độ lai quá cao sẽ cản trở sự bắt cặp của primer vào DNA bản mẫu, do đó hiệu quả nhân bản sẽ không cao. Công thức tính nhiệt độ lai: 1. Công thức chính xác với primer dài không quá 20nu: Tm= [4(G+C)+2(A+T)] 0C. Đây là công thức Wallace chung nhất hay được sử dụng, xác định gốc phân tử lai oligonucleotide, được thực hiện trong 1M NaCl, ở nồng độ muối thấp. 2. Công thức này dùng cho primer có độ dài 14-70nu: Tms={81,5+16,6(log10[J +]+0,41(%G+C)-(600/l)}0C [J+] là nồng độ phân tử của cation hóa trị đơn và l= độ dài oligonucleotide, (%G+C) là giá trị thực chứ không phải giá trị phân số (ví dụ: (%G+C)=90% là 90 chứ không phải 0,90). 3. Công thức này dùng cho primer có độ dài 20-35nu: Tmp={22+1,46[2(G+C)+(A+T)] 0C Nhiệt độ primer tính theo lý thuyết là nhiệt độ tham khảo, nhiệt độ bắt cặp thực sự có thể cao hơn 3-120C so với nhiệt tính toán. Chúng tôi tiến hành khảo sát nhiệt độ lai của từng cặp primers trên một gradient nhiệt độ, khảo sát ở các giếng khác nhau trong khoảng 55-650C, và đọc kết quả so sánh. 2.3.4.2. Khảo sát nồng độ MgCl2+ [4], [15] Trong dung dịch đệm quan trọng nhất là ion Mg 2+ làm tăng nhiệt độ nóng chảy (Tm-melting temperature) của DNA mạch đôi, tạo ra phức chất tan với dNTPs để hình thành cơ chất mà enzyme polimerase có thể nhận ra, điều này rất cần thiết cho quá trình liên kết của các dNTP. Nồng độ Mg 2+ trong hỗn hợp phản ứng cuối cùng biến đổi từ 0,5-5,5mM (nồng độ này có thể thay đổi khi cần thiết). Nồng độ Mg 2+ quá thấp sẽ làm giảm khả năng tổng hợp của enzyme polymerase, hiệu suất thu sản phẩm thấp hoặc không có sản phẩm, còn nếu nồng độ quá cao sẽ tạo ra những phân đoạn không đặc hiệu (primer sai vị trí). Nhìn chung, nồng độ MgCl 2 có ảnh hưởng nhiều tới hiệu quả và tính đặc thù của phản ứng. Ngoài Mg 2+ còn một số chất khác trong dung dịch đệm như AMSO, DMSO, formamide được thêm vào như các chất phụ gia nhằm tạo ra các sản phẩm PCR có kích thước lớn. Chúng tôi tiến hành khảo sát nồng độ MgCl2 với một dãy nồng độ từ 2-5 mM. 2.3.4.3. Khảo sát nồng độ primer và TaqMan probe [1] * Thăm dò nồng độ primer Lượng primer đưa vào phản ứng PCR phải phù hợp với lượng DNA cần tổng hợp. Nếu nồng độ primer quá thấp thì primer sẽ hết trước khi số chu kì kết thúc, còn nồng độ primer quá cao thì sẽ dễ làm tăng sản phẩm không đặc hiệu. Nồng độ primer không được cao quá, vì các phân tử Mg 2+ bị cặp hết làm giảm hoạt tính enzym, thể tích mẫu không vượt quá 1/10 thể tích. Trên 200M, thì phải tối ưu lại Mg, tránh sử dụng đệm EDTA vì EDTA bắt kẹp Mg2+. Nồng độ primer thường 0,2M là đủ cho các primer tương tự, cũng có thể sử dụng đến 3M, nhưng tỷ lệ giữa primer và khuôn cao có thể cho kết quả khuyếch đại không đặc hiệu và tạo ra cấu trúc nhị phân primer. Nồng độ primer trong mỗi phản ứng PCR phải được tính toán tối ưu bằng thực nghiệm. Nồng độ primer thích hợp để tiến hành phản ứng PCR là từ 0,1-0,5μM. * Thăm dò nồng độ TaqMan probe để có cường độ huỳnh quang là cao nhất, không phải hàm lượng TaqMan cao là cho cường độ phát huỳnh quang cao, ngược lại sẽ làm các phân tử TaqMan probe quá gần nhau nên huỳnh quang phát ra từ đầu reporter của TaqMan probe được thủy giải sẽ bị các quencher của các TaqMan probe khác hấp phụ. Thông thường từ 2-5pm cho mỗi thể tích phản ứng. Vì vậy, chúng tôi chọn phổ nồng độ TaqMan probe từ 100nM-500nM. 2.3.5. Phương pháp khảo sát độ nhạy và khả năng nhân bản chọn lọc của primer và TaqMan probe. 2.3.5.1. Khảo sát độ nhạy Bất kỳ phương pháp nào, các đối tượng mục tiêu cũng chỉ có thể được phát hiện ở một nồng độ giới hạn của chúng trong mẫu. Một phương pháp tốt khi nó có thể phát hiện được đối tượng quan tâm ở nồng độ càng thấp càng tốt. Do đó, đây là một chỉ tiêu quan trọng dùng để đánh giá mức độ hiệu quả của phương pháp. Trong nghiên cứu này, để xác định độ nhạy của primer, chúng tôi tiến hành pha loãng bậc 10 liên tiếp mẫu ban đầu (đã biết trước nồng độ) thành nhiều nồng độ khác nhau. Ở mỗi nồng độ chúng tôi tiến hành khảo sát với những điều kiện tối ưu đã được khảo sát từ các thí nghiệm trên. Từ đó chúng tôi sẽ xác định nồng độ thấp nhất mà phương pháp vẫn cho kết quả rõ ràng và chính xác. 2.3.5.2. Khảo sát khả năng nhân bản chọn lọc của primer và TaqMan probe Một yêu cầu quan trọng của hệ primers và TaqMan probe là nó phải khuếch đại đúng trình tự mục tiều cần quan tâm. Ngoài trình tự mục tiêu của loài đang khảo sát, primer và probe không được bắt cặp lên các trình tự của loài khác. Do đó việc xác định khả năng nhân bản chọn lọc của primer luôn luôn được đòi hỏi. Việc xác định này phải được thực hiện trên cả lý thuyết và thực nghiệm. Trên lý thuyết, chúng tôi sử dụng phần mềm Annhyb 4.942 để kiểm tra sự bắt cặp của primer trên genome của một số loài cùng họ như HSV1, HSV2, EBV và một số loài khác HBV, HCV, HPV, MTB….. Trên thực nghiệm đối với mỗi tác nhân, chúng tôi tiến hành song song hai phản ứng Real- Time PCR. Một chúng tôi dùng hệ primers và TaqMan probe đã thiết kế chạy với những mẫu bệnh phẩm nhiễm HSV1, HSV2, EBV, HBV, HCV, HPV,MTB đã được khẳng định dương tính. Một phản ứng với các cặp primer-TaqMan probe đặc hiệu cho từng tác nhân. 2.3.6. Phương pháp giải trình tự (sequencing) Để biết sản phẩm khuyếch đại thu được là đặc hiệu của vùng gen UL123–CMV đã thiết kế theo gene bank, sản phẩm phải được gửi đi giải trình tự nucleotide, ở công ty Macrogenn Inc (Hàn quốc). Nguyên tắc đoạn DNA cần được giải được chạy Real-Time PCR, sau đó mỗi mạch của phân tử DNA sẽ bắt cặp với một primer, thường là mổi sử dụng trong phản ứng Real-Time PCR, xảy ra với sự có mặt của dideoxyribonucleotide đã được đánh dấu bằng mỗi màu khác nhau. 2.3.7. Phương pháp xây dựng đường chuẩn (Standard curve) Đường cong chuẩn được xây dựng với các mẫu chuẩn đã có nồng độ DNA-CMV biết trước. Sau đó, hàm lượng sản phẩm PCR của mẫu xét nghiệm sẽ được xác định bằng cách so sánh với hàm lượng sản phẩm PCR từ các mẫu chuẩn được nhân bản cùng lúc thông qua đường cong chuẩn vừa xây dựng này [2]. CHƯƠNG 3: KẾT QUẢ VÀ BIỆN LUẬN 3.1. Kết quả xây dựng quy trình 3.1.1. Kết quả thiết kế hệ primers và TaqMan probe trên lý thuyết Việc lựa chọn vùng trình tự mục tiêu để thiết kế primer để phát hiện CMV cho đến nay vẫn chưa có kết quả nào xác định vùng trình tự tối ưu trong số các gen như: UL54(được sử dụng trong kit Cobas Amplicor CMV monitor- Roche Diagnotics), UL55 (gB), UL123 (IE), UL83 (pp65), US17. Theo kết quả mới nhất của công trình nghiên cứu Nada Madi & cs – 2007 [56], và một số tác giả khác [49], [53]), [61] chúng tôi chọn vùng bảo tồn của gen UL 123-CMV. 3.1.1.1. Trình tự sản phẩm khuyếch đại một đoạn của gen UL 123-CMV  Đầu tiên, chúng tôi tiến hành download tất cả các trình tự gen UL 123 của CMV trên NCBI, gồm có 12 trình tự với mã gen như sau: 1. GI:222354438- mã FJ 616285,1 2. GI:219879708- mã FJ 527563,1 3. GI:39841729- mã GQ 466044 4. GI:52139287- mã NC 006273 5. GI:254771140- mã GQ 396663 6. GI:254770974- mã GQ 396662 7. GI:39841819- mã GQ 221974 8. GI:242345887- mã GQ 221975 9. GI:242345721- mã GQ 221973 10. GI:39842122- mã AY 446894 11. GI:239909470- mã GQ 121041 12. GI:27808742-mã BK 000394  Sau khi tải xong 12 trình tự gen trên, sử dụng chương trình ClustalX để tìm vùng bảo tồn cao nhất, và kiểm tra bằng phần mềm Annhyb, trình tự DNA đích được chọn là một đoạn trình tự dài 98bp thuộc vùng UL123 (dài khoảng 1760bp) của bộ gen CMV.  Kết quả trình tự sản phẩm khuyếch đại Vị trí 974- gen UL123–CMV 3’ATCCACATCTCCCGCTTATCCTCAGGTACAATGTAGTTCTCATACATGCTCTGCATAGT TAGCCCAATACACTTCATCTCCTCGAAAGGCTCATGAAC5’- vị trí 1071-gen UL123–CMV 3.1.1.2. Trình tự nucleotide của hệ primers và TaqMan probe  Dựa trên phần mềm ClustalX và sự tương đồng giữa các gen UL 123 của bộ gen CMV đã tải về, chúng tôi đã thiết kế trình tự cặp primers và TaqMan probe (bảng 3.1) Bảng 3.1: Trình tự nucleotide của primers và TaqMan probe Tên Trình tự nucleotit Vị trí trên gen UL123 Primer xuôi 5’-ATCCACATCTCCCGCTTATCC-3’ 974-993 Primer ngược ® 5’-TCCTCGAAAGGCTCATGAAC-3’ 1052- 1071 TaqMan probe 5’TCTCATACATGCTCTGCATAGTTAGCC CAA3’ 1011- 1040  Kết quả chạy ClustalX hệ primers –TaqMan probe vừa thiết kế  Với primer xuôi: Hình 3.1: Kết quả của việc tìm độ tương đồng của primer xuôi Nhận xét: Tỷ lệ tương đồng giữa primer xuôi và các đoạn gen UL123-CMV là 100% .  Với primer ngược: Hình 3.2: Kết quả của việc tìm độ tương đồng của primer ngược Nhận xét: Tỷ lệ tương đồng giữa primer ngược và các đoạn gen UL123-CMV cũng là 100% .  Với TaqMan probe: Hình 3.3: Kết quả của việc tìm độ tương đồng của TaqMan probe Nhận xét: Tỉ lệ tương đồng của probe với 12 đoạn gene UL123 là 100%.  Kết quả chạy Annhyb cho hệ primers – TaqMan probe Đối với Gen GI:219879708: trình tự primer xuôi, TaqMan probe, và primer ngược được thể hiện hình 3.4: Hình 3.4: Kết quả của việc đánh giá primer, TaqMan probe bằng Annhyb  Kết quả khảo sát trên Blast: (kết quả blast sẽ được trình bày ở phần phụ lục). Kết quả khảo sát trên Blast (ó giá trị E-value là một thông số thể hiện mức độ tin cậy về sự tương đồng giữa hai trình tự. Giá trị này càng nhỏ hoặc bằng 0 thì sự tương đồng giữa các trình tự càng có ý nghĩa. Qua kết quả chúng tôi thấy trong tất cả các trường hợp đều có giá trị E-value rất thấp trong khoảng từ 3x10-7 - 0,048. Với giá trị E-value này thì sự tương đồng giữa các trình tự rất có ý nghĩa. Bên cạnh giá trị E-value thì phần trăm tương đồng giữa sản phẩm PCR mà chúng tôi thu được với các trình tự thuộc UL123-CMV là 100%. Kết quả trên cho phép chúng tôi có thể nhận định đoạn trình tự mà chúng tôi nhân bản được là đặc hiệu của Humanherpesvirus 5, gen mã hóa protein immediate-early, exon4, chúng tôi thấy rằng trình tự primer hầu hết đều tương đồng với CMV và không xuất hiện trình tự nào khác. Điều này chứng tỏ hệ primers-TaqMan probe do chúng tôi thiết kế có độ chuyên biệt cao về mặt lý thuyết. Nhận xét: Tỷ lệ tương đồng giữa hệ primers–TaqMan probe với gen UL123-CMV – exon 4 là 100%. 3.1.1.3. Kết quả khảo sát đặc tính của primer và TaqMan probe Để kiểm tra đặc tính của primer và TaqMan probe về nhiệt độ lai, kích thước primer, các cấu trúc thứ cấp, chúng tôi sử dụng phần mềm Annhyb và phần mềm trực tuyến oligo Analyzer 3.0 của IDT.  Kết quả đại diện trên oligo Analyzer 3.0 của IDT ( Hình 3.5 : Kết quả trên IDT đoạn primer xuôi  Kết quả đại diện trên Annhyb Hình 3.6: Kết quả Annhyb khảo sát đặc tính primer xuôi . Trên kết quả khảo sát của các phần mềm, chúng tôi tóm tắt các đặc tính của hệ primers và TaqMan probe (bảng 3.2). Bảng 3.2: Các đặc tính của primers và TaqMan probe Yếu tố kiểm tra Kết quả kiểm tra Primer xuôi Primer ngược TaqMan Probe Kích thước 21 bp 20 bp 30 bp % GC 52,4% 50 % 43,3 % Nhiệt độ nóng chảy 55,6 0C 54 0C 61 0C (Tm) Cấu trúc kẹp tóc hairpin loop (kcal/mole) ΔG= 2,48 ΔG= -0,78 ΔG= -1,44 Cấu trúc Self-dimer (kcal/mole) ΔG= -3,61 ΔG= -8,53 ΔG= -7,05 Cấu trúc hetero- dimer(kcal/mole) Primer ngược ΔG= -4,74 Với primer xuôi : ΔG= -4,74 Với primer xuôi : ΔG= -4,74 Với probe : ΔG=-4,74 Với probe : ΔG= -6,6 Với primer ngược ΔG= -6,6 Dựa trên kết quả khảo sát đặc tính primers, TaqMan Probe (bảng 3.2), chúng tôi nhận thấy:  Về mặt kích thước, cả 2 primers và TaqMan probe trên đạt yêu cầu về chiều dài tốt nhất của primer (20 – 30bp).  Về thành phần %GC, các primers-TaqMan probe trên có %GC nằm trong tỉ lệ tốt nhất (40% - 60%).  Nhiệt độ lai của primer và TaqMan probe thỏa mãn điều kiện thiết kế (TaqMan probe có nhiệt độ nóng chảy cao hơn primer 5-100C, ở giai đọan 600C là nhiệt độ bắt cặp tối ưu của TaqMan probe, TaqMan probe sẽ bắt cặp vào sợi đích trước, rồi primer mới bắt cặp).  Cấu trúc thứ cấp thể hiện ở phần phụ lục: bao gồm hairpin loop (cấu trúc kẹp tóc), self dimer (oligonucleotide tự bắt cặp với chính nó), hetero dimer (sự bắt cặp giữa hai oligonucleotide khác nhau). Trong phản ứng PCR, nếu cấu trúc bậc hai này càng bền vững bao nhiêu thì hiệu quả nhân bản càng giảm đi bấy nhiêu. Độ bền vững của các cấu trúc thứ cấp được đo bằng chỉ số năng lượng tự do (∆G, kcal/mole), chỉ số này phải lớn hơn -9kcal (theo hãng IDT) vì ∆G càng lớn bao nhiêu thì cấu trúc càng kém bền bấy nhiêu, do đó sẽ không ảnh hưởng đến hoạt động của PCR. Kết quả khảo sát trên phần mềm trực tuyến IDT oligo analyzer cho thấy, tất cả cấu trúc thứ cấp của hệ primers – mẫu dò đều có ∆G > -9kcal, nằm trong khoảng cho phép chấp nhận được. Kết luận, về mặt lý thuyết hệ primers và TaqMan probe của chúng tôi có thể chấp nhận. 3.1.2. Kết quả hệ primers và TaqMan probe bằng thực nghiệm 3.1.2.1. Kiểm tra khả năng hoạt động của hệ primers–TaqMan probe bằng Real - Time PCR Chúng tôi chạy thử nghiệm hệ primers - TaqMan probe trên mẫu bệnh phẩm đã được khẳng định dương tính bằng Real-Time PCR từ kit CMV của Roche (Light Cycler® CMV Quant kit-04- 845-854-001 ở trung tâm Y khoa Medic (thông tin mẫu ở phần phụ lục có mã số 5089) với kit của chúng tôi thiết kế. Mẫu được tách chiết DNA-CMV trong huyết thanh. Quá trình này nhằm mục đích kiểm tra khả năng bắt cặp, khuếch đại và phát tín hiệu huỳnh quang của hệ primers – probe trên gene UL123 của CMV. Để kiểm tra hiện tượng ngoại nhiễm có thể xảy ra trong quá trình thí nghiệm, chúng tôi bố trí thêm một mẫu chứng âm với những thành phần phản ứng không đổi nhưng thay nguồn DNA bằng nước cất vô trùng. Kết quả chạy thực nghiệm: (hình 3.7) Hình 3.7: Đường cong biểu diễn sự hoạt động của hệ primers – TaqMan probe bằng thực nghiệm. Kết quả chạy Real-Time PCR cho thấy, hệ primers và TaqMan probe hoạt động tốt, mẫu dương tính ở chu kỳ ngưỡng 33,9, tương đương 3x103 copies virus/ml mẫu thử, phù hợp kết quả xét nghiệm của trung tâm y khoa Medic . Đường cong PCR lên đều và đẹp, không có hiện tượng nhiễu tín hiệu huỳnh quang. Chứng âm cho kết quả âm tính chứng tỏ mọi hoạt động trong quy trình thử nghiệm đều tốt, không có hiện tượng ngoại nhiễm. Như vậy, hệ primers-TaqMan probe CMV được thiết kế hoạt động hiệu quả trong phản ứng Real-Time PCR. UL123_-CMV- mẫu 5089 Chứng âm 3.1.2.2. Kết quả khảo sát khả năng nhân bản chọn lọc của hệ primers và probe được thiết kế  Trên lý thuyết, bằng phần mềm Annhyb 4,942 và trình tự genome của các tác nhân HSV1, HSV2, VZV, EBV, HBV, HCV, HPV, vi khẩn lao từ Genbank, chúng tôi tiến hành khảo sát khả năng bắt cặp của hệ primers – TaqMan probe, kết quả khảo sát (bảng 3.3). Bảng 3.3: Kết quả khảo sát độ đặc hiệu của hệ primers – TaqMan probe thiết kế với một số loài virus khác Tên chủng HSV1 HSV2 VZV EBV HBV HCV HPV MTB Phần trăm (%) bắt cặp Primer xuôi 61,9 58,1 54,3 54,3 53,3 48,1 49,5 59,5 Primer ngược 50,5 56 61 52 42 51,5 45 61,5 Probe 39 39,7 47,7 41 31,7 38,7 37,7 44,3 Qua kết quả bảng 3.3, chúng tôi thấy phần trăm bắt cặp giữa hệ primers-TaqMan probe của CMV trên genome của các loài HSV-1, HSV-2, VZV, EBV, HBV, HCV, HPV, vi khẩn lao đều không cao, đối với primer xuôi dao động trong khoảng 48,1% đến 61,9%, với primer ngược trong khoảng 42%-61,5%, còn với probe nằm trong khoảng 39%-44,3% khẳng định hệ primers-TaqMan probe được thiết kế là đặc hiệu cho CMV.  Trên thực nghiệm, chúng tôi tiến hành song song hai phản ứng Real-Time PCR , một bằng hệ primers-probe cho CMV và một bằng hệ primers-probe đã thiết kế cho từng mẫu chứa DNA của các loài HSV1, HSV2, EBV, HBV, HPV, MTB, HCV (hệ primers-probe cho mỗi tác nhân, xem phụ lục). Các mẫu chứa DNA của HBV, HPV, HCV, EBV, MTB được khẳng định dương tính bằng phản ứng Real-Time PCR của công ty cổ phần công nghệ Việt Á, còn DNA chứa HSV-1, HSV-2, được tách chiết từ mẫu huyết thanh có kết quả IgG dương tính của trung tâm y khoa Medic. Kết quả chạy phản ứng giữa các loài với hệ primers- TaqMan probe đặc hiệu cho từng loài thì dương tính còn đối với hệ primers- TaqMan probe của CMV thì âm tính (bảng 3.4). Bảng 3.4: Kết quả nhân bản các loài với hệ primers- TaqMan probe đặc hiệu loài Mẫu chứa virus Chu kỳ ngưỡng (Ct) Lần 1 Lần 2 Lần 3 EBV 32,5 29,4 29,3 MTB 29,7 28,6 28,7 HBV 22,1 21,1 21 HCV 28,7 27,7 27,9 HPV 26,9 25,9 25,8 CMV 34 32 31,8 HSV 26,4 25 25,2 3.1.2.3. Kết quả giải trình tự sản phẩm PCR (bảng 3.5) Chúng tôi kiểm tra tính đặc hiệu của sản phẩm PCR nhận được với hệ primers-TaqMan probe đã thiết kế bằng kỹ thuật giải trình tự sản phẩm PCR. Primer sử dụng cho giải trình tự là primer đặc hiệu cho CMV đã thiết kế, chúng tôi chọn ngẫu nhiên từ một mẫu đã nhân bản (mẫu mã số 5089), gởi đi công ty Macrogenn Inc (Hàn quốc) để kiểm tra tính đặc hiệu của sản phẩm PCR khuếch đại (xem kết quả gốc ở phụ lục). Bảng 3.5: Kết quả giải trình tự Trình tự Chiều dài CCNCNTATCCTCAGGTACAACGTAGTTCTNATACATGCT CTACATAGTATAGCCCAATACACTTNATCTCCTCGNAAG GCTCATNAAC 88bp Ghi chú: (N: nucleotide không xác định được) Một điều cần lưu ý trong kết quả giải trình tự là số lượng các N, nếu kết quả giải trình tự có nhiều ký tự N thì kết quả không sử dụng được. Ở đây, kết quả mà chúng tôi nhận được có 6N (6/88). Tỷ lệ N trong trình tự chiếm tỷ lệ thấp nên kết quả này có thể chấp nhận được. Với kết quả giải trình tự ở trên, chúng tôi nhận thấy kích thước của sản phẩm nhân bản được chỉ có 88bp, nhỏ hơn so với trên lý thuyết là 98bp. Nguyên nhân là do máy giải trình tự thường không giải được một số nucleotide đầu tiên và mặt khác, vì chúng tôi sử dụng chính các primer của chính phản ứng PCR để làm primer trong phản ứng giải trình tự, do đó trình tự các sản phẩm PCR giải ra bị mất một đoạn khoảng 11 nucleotide về phía đầu 5’, nơi primer xuôi bắt vào. Hình 3.8: Kết quả gióng cột sản phẩm khuếch đại theo lý thuyết (sp) và kết quả giải trình tự (CMV- ab1.2800) bằng phần mềm ClustalX Qua hình 3.8, chúng tôi nhận thấy vùng trình tự không tương đồng là 9/88 nucleotide=10,22%, vùng trình tự tương đồng giữa sản phẩm PCR thu được với các trình tự CMV đã công bố chiếm 89,78%. Tỉ lệ này cho phép kết luận sản phẩm PCR chúng tôi nhân bản là đặc hiệu cho CMV.  Kết quả kiểm tra sản phẩm giải trình tự trên Blast: Hình 3.9: kết quả khảo sát sản phẩm giải trình tự bằng Blast Qua hình 3.9 chúng tôi thấy sự tương đồng giữa sản phẩm PCR mà chúng tôi nhân bản được với các trình tự thuộc HCMV, vùng gen IE từ 89%-91%. Với giá trị E-value từ 4x10-55- 4x10- 60 thì sự tương đồng giữa các trình tự rất có ý nghĩa. KẾT LUẬN: hệ primerss – TaqMan probe của chúng tôi hoạt động tốt, đặc hiệu và chuyên biệt, có thể ứng dụng được vào quy trình. 3.1.3. Kết quả khảo sát điều kiện tối ưu hóa của phản ứng 3.1.3.1. Kêt quả khảo sát nhiệt độ lai tối ưu Từ nhiệt độ biến tính của primer xuôi và primer ngược được sử dụng, chúng tôi tiến hành khảo sát nhiệt độ lai cho phản ứng từ 550C đến 650C. Ngoại trừ sự thay đổi về nhiệt độ lai còn các thành phần khác (DNA bản mẫu, primer,…) và các điều kiện khác (điều kiện về thiết bị, thời gian phản ứng,…) của phản ứng đều được giữ nguyên và đồng nhất, thí nghiệm được lặp lại 3 lần (bảng 3.6) Bảng 3.6: Kết quả khảo sát nhiệt độ lai Nhiệt độ lai (Ct) lần 1 (Ct) lần 2 (Ct) lần 3 (Ct) TB Chứng âm (550C) N/A N/A N/A N/A 55,00C 25,9 25,4 26,2 25,8 55,80C 27,6 25,8 25,4 26,3 57,10C 24,9 25 24,6 24,8 58,90C 25,4 25,5 25,5 25,5 61,40C 26,1 25,5 25 25,5 63,30C 25,8 25,9 25,5 25,7 64,50C 26,2 24,6 25,9 25,6 650C 26,2 25,2 28,8 26,7 Nhận xét: ở nhiệt độ 57,10C xuất hiện chu kỳ ngưỡng thấp nhất, và được chọn là nhiệt độ lai tối ưu cho phản ứng. Hình 3.10: Đường cong biểu diễn khảo sát nhiệt độ lai Kết luận: Primer hoạt động tốt ở nhiệt độ lai là 57,10C . 3.1.3.2. Kết quả khảo sát nồng độ Mg2+ Khi tiến hành khảo sát nồng độ MgCl2, chúng tôi tiến hành các phản ứng ở cùng nhiệt độ lai 570C, thành phần các chất tham gia phản ứng là như nhau, chỉ khác biệt về nồng độ MgCl2, chúng tôi lặp lại thí nghiệm ba lần và kết quả thu được (bảng 3.7). Bảng 3.7: Kết quả khảo sát nồng độ MgCl2 MgCl2 (mM) (Ct) lần 1 (Ct) lần 2 (Ct) lần 3 (Ct) TB 1,5 (+) 26 / 26,3 / 2,0 26 26 26,3 26,1 2,5 25,7 25,7 26 25,8 3,0 26 26 26,2 26,1 3,5 25,3 25,3 25,6 25,4 4,0 25,8 25,8 26,1 25,9 4,5 27,4 26 27,8 27,1 5,0 25,4 27,4 25,5 26,1 1,5 (-) Âm tính Âm tính Âm tính Hình 3.11: đường cong biểu diễn khảo sát nồng độ Mg2+ Qua kết quả chúng tôi nhận thấy ở nồng độ MgCl2 = 3,5mM ở chu kỳ ngưỡng thấp nhất đã có tín hiệu huỳnh quang, do đó chúng tôi chọn nồng độ MgCl2=3,5mM là tối ưu cho phản ứng. 3.1.3.3. Kết quả khảo sát nồng độ primer và TaqMan probe * Kết quả khảo sát nồng độ TaqMan probe: Nồng độ TaqMan probe có ảnh hưởng đến hiệu quả phản ứng Real-Time PCR, nếu nồng độ này quá thấp thì tín hiệu yếu, còn quá cao sẽ lãng phí và có thể gây ảnh hưởng xấu đến phản ứng. Theo các nghiên cứu trước đây, nồng độ TaqMan probe trong phản ứng Real-Time PCR dao động trong khoảng 100nM đến 500nM. Vì vậy, chúng tôi chọn phổ nồng độ từ 100-500nM với đơn vị tăng là 100nM nhằm tìm ra nồng độ cho giá trị Ct nhỏ nhất, thí nghiệm được lặp lại ba lần và kết quả được trình bày ở bảng 3.8. Bảng 3.8: Khảo sát nồng độ TaqMan probe Nồng độ probe Chu kỳ ngưỡng (Ct) Chu kỳ ngưỡng trung bình Lần 1 Lần 2 Lần 3 100nM 24,8 24,8 24,3 24,6 200nM 24,6 23,8 23,6 24,0 300nM 23,7 23,7 23,7 23,7 400nM 24,7 24,5 24,4 24,5 500nM 24,7 24,5 24,9 24,7 Hình 3.12: Biểu diễn đường cong khảo sát nồng độ TaqMan probe Kết quả bảng (3.8) cho thấy nồng độ TaqMan probe CMV= 300nM cho giá trị Ct nhỏ nhất, nồng độ này được sử dụng cho nghiên cứu tiếp theo. * Kết quả khảo sát nồng độ primer: Nếu nồng độ primer quá thấp thì primer sẽ hết trước khi số chu kì kết thúc, còn nồng độ primer quá cao thì sẽ dễ làm tăng sản phẩm không đặc hiệu. Vì vậy, chúng tôi tiến hành khảo nghiệm nồng độ primer từ 0,1 đến 0,5μM ba lần (bảng 3.9) để tìm giá trị Ct nhỏ nhất. Bảng 3.9: Kết quả khảo sát nồng độ primer Nồng độ Primer (μM) Chu kỳ ngưỡng (Ct) Chu kỳ ngưỡng trung bình Lần 1 Lần 2 Lần 3 0,1 25,2 26,9 27,6 26,6 0,2 25,6 26,1 26 25,9 0,3 26 25,8 26,8 26,2 0,4 24,7 25,4 25,4 25,2 0,5 25,3 26 25,8 25,7 Qua kết quả bảng cho thấy ở nồng độ primer là 0,4μM cho giá trị Ct thấp nhất. Hình 3.13:Biểu diễn đường cong của nồng độ primer 3.1.4. Kết quả khảo sát độ nhạy của phản ứng  Độ nhạy là một yếu tố quyết định giá trị của phương pháp chẩn đoán. Độ nhạy cho biết giới hạn số lượng bản mẫu DNA nhỏ nhất mà một phương pháp có thể phát hiện. Chúng tôi khảo sát độ nhạy của phản ứng Real-Time PCR CMV với các nồng độ mẫu chuẩn từ 101 đến 106 bản sao phản ứng. Thí nghiệm được lặp lại ba lần và kết quả được thể hiện trong bảng 3.10 Bảng 3.10: Kết quả khảo sát độ nhạy Nồng độ mẫu chuẩn (bản sao/ ml) Chu kỳ ngưỡng (Ct) Chu kỳ ngưỡng trung bình Lần 1 Lần 2 Lần 3 101 (-) (-) (-) (-) 102 34 34,2 33,8 34,0 103 29,6 29,6 29,4 29,5 104 26,8 26,3 26,6 26,6 105 23,1 22,2 22,9 22,7 106 19 19,4 18,7 19,0 Hình 3.14: Đường cong biểu diễn kết quả khảo sát độ nhạy  Qua kết quả chúng tôi nhận thấy giới hạn phát hiện DNA-CMV của phản ứng chúng tôi là 102 bản sao/phản ứng.  Xây dựng đường cong chuẩn Với các mẫu chuẩn có số lượng bản sao CMV đã biết 102, 104, 106 chúng tôi xây dựng đường chuẩn cho phản ứng định lượng CMV, từ đường chuẩn này có thể xác định được hàm lượng virus trong bệnh phẩm. Kết quả đường chuẩn qua ba lần thí nghiệm (hình 3.15). Lần 1 Hình 3.15: Đường chuẩn . Qua ba lần khảo sát, hệ số tuyến tính của đường chuẩn thể hiện ở bảng 3.11 Bảng 3.11: Hiệu quả phản ứng Real-Time PCR Lần 1 Lần 2 Lần 3 PCR eficiency (hiệu quả khuyếch đại) 96,2% 103,9% 101% Hệ số tuyến tính của đường chuẩn 1,0 1,0 1,0 Hệ số tuyến tính của đường chuẩn ba lần đều =1,0, trong qui định (R2>0,98), hiệu quả khuyếch đại từ 96,2% - 103,9% (qui định 90%-105%). Trên cơ sở đó cho thấy phản ứng Real- Time PCR của chúng tôi là hiệu quả và đạt mức độ tối ưu. Các trị số 2,3,4,5,6 trên trục X được biểu thị bằng cơ số logarit của cơ số 10 (log10) tức là tương ứng với các số lượng bản đích là 102, 103, 104, 105, 106 copies trong phản ứng. 3.1.5.Khảo sát tính lặp lại của phản ứng Real-Time PCR Độ tin cậy của thí nghiệm được thể hiện qua nhiều yếu tố trong đó tính lặp lại là một yếu tố quan trọng. Tính lặp lại của phản ứng Real-Time PCR được biểu hiện qua hai hệ số biến thiên (variability coefficient) gồm biến thiên liên phản ứng và biến thiên nội phản ứng. Giá trị các hệ số Lần 2 Lần 3 biến thiên này càng thấp thì tính lặp lại càng cao. Biến thiên nội phản ứng là độ biến thiên giữa các phản ứng được thực hiện vào cùng một thời điểm. Biến thiên liên phản ứng là độ biến thiên giữa các lần lặp lại phản ứng vào các thời điểm khác nhau. Chu kỳ ngưỡng là yếu tố để đánh giá độ biến thiên này. Chúng tôi tiến hành khảo sát hệ số biến thiên nội phản ứng (HSBTNPƯ), và hệ số biến thiên liên phản ứng (HSBTLPƯ) trên mẫu chuẩn CMV với các nồng độ 102, 104, 106 bản sao/phản ứng và hai mẫu bệnh phẩm , thí nghiệm được lặp lại ba lần. 3.1.5.1. Hệ số biến thiên nội phản ứng (intraassay variability coefficicent) Hình 3.16: Đường cong biểu diễn nội phản ứng Standard Curve Graph for FAM-490 Hình 3.17: đồ thị giá trị Ct các lần lặp lại của nội phản ứng Bảng 3.12: Giá trị Ct các nồng độ của đường chuẩn trong nội phản ứng Nồng độ (bảnsao/phản ứng) Ct lần 1 Ct lần 2 Ct lần 3 Ct trung bình 102 31,25 32,56 33,85 32,55 104 28,10 27,58 27,60 27,76 106 20,20 19,48 19,05 19,58 Mẫu 1 26,75 27,04 25,76 26,52 Mẫu 2 35,63 34,97 34,59 35,06 Theo thống kê mô tả trong MS-Excel [5] (phụ lục), chúng tôi tiến hành tính toán hệ số biến thiên nội phản ứng của phản ứng Real-Time PCR (bảng 3.13) Bảng 3.13: hệ số biến thiên nội phản ứng (HSBTNPƯ) Nồng độ (bản sao/ phản ứng) Ct trung bình Độ lệch chuẩn HSBTNPƯ 102 32,55 1,30 3,99 104 27,76 0,29 1,06 106 19,58 0,58 2,97 Mẫu 1 26,52 0,67 2,53 Mẫu 2 35,06 0,53 1,5 3.1.5.2. Hệ số biến thiên liên phản ứng (inter-assay variability coefficient) Ngày 1: Unknows: mẫu thử Standards: mẫu chuẩn Ngày 2 Ngày 3 Hình 3.18: Đồ thị giá trị Ct lặp lại của liên phản ứng Bảng 3.14: Giá trị chu kỳ ngưỡng các nồng độ của đường chuẩn liên phản ứng Nồng độ (bản sao/ phản ứng) Ct lần 1 Ct lần 2 Ct lần 3 Ct trung bình 102 36,13 35,44 33,99 35,19 104 28,71 27,80 27,08 27,86 106 22,65 21,64 20,75 21,68 Mẫu 1 29,52 28,48 26,29 28,10 Mẫu 2 26,28 25,54 22,97 24,93 Dựa vào kết quả bàng 3.14, chúng tôi tiến hành tính toán theo thống kê mô tả trong MS- EXCEL [5] (phụ lục), kết quả bảng 3.15. Bảng 3.15: Hệ số biến thiên liên phản ứng (HSBTLPƯ) Nồng độ (bản sao/phản ứng) Ct trungbình Độ lệch chuẩn HSBTLPƯ 102 35,19 1,09 3,10 104 27,86 0,82 2,93 106 21,68 0,95 4,38 Mẫu 1 26,01 1,65 5,87 Mẫu 2 27,02 1,74 6,97 Độ lặp lại của phản ứng Real-Time PCR CMV thông qua các hệ số biến thiên nội phản ứng và liên phản ứng được tổng kết trong bảng 3.16. Bảng 3.16: HSBTNPƯ và HSBTLPƯ của Real-Time PCR CMV Hệ số Mẫu chuẩn (bản sao/phản ứng) Mẫu bệnh phẩm 102 104 106 Mẫu 1 Mẫu 2 BTNPƯ 3,99 1,06 2,97 2,53 1,50 BTLPƯ 3,1 2,93 4,38 5,87 6,97 Bảng 3.17: Kết quả so sánh độ lặp lại trong một số công trình Tác giả Độ lặp lại Độ nhạy HSBTNPƯ HSBTLPƯ Machida & cs (2000) [48] 0,89 – 1,43 1,51 – 4,46 102 Gault & cs (2001) [26] 0,6 – 2,5 12 - 21 101 Heli Piiparinen (2004) [33] 5,12 – 13,1 4,5 – 19,6 101 Thí nghiệm 1,06-3,99 2,93 - 6,97 102 So sánh với các kết quả công bố của một số tác giả (bảng 3.17) cho thấy kết quả phản ứng Real-Time PCR của chúng tôi phù hợp với các kết quả đã công bố, chứng tỏ quy trình chúng tôi xây dựng hoạt động tốt. 3.2. ỨNG DỤNG QUY TRÌNH ĐỊNH LƯỢNG CMV TRÊN MỘT SỐ BỆNH PHẨM Sau khi tối ưu hóa quy trình định lượng CMV bằng Real-Time PCR, chúng tôi tiến hành ứng dụng trên một số mẫu bệnh phẩm nghi ngờ nhiễm CMV. Trong khóa luận này, chúng tôi tiến hành ứng dụng khảo sát hai đợt: Đợt 1: gồm 10 mẫu nước tiểu từ bệnh viện Từ Dũ (bảng 3.18) và 10 mẫu huyết thanh từ trung tâm xét nghiệm Y khoa Medic và bệnh viện Từ Dũ (bảng 3.19) Bảng 3.18: Kết quả khảo sát mẫu nước tiểu từ bệnh viện Từ Dũ bằng quy trình Real-Time PCR STT Mã số mẫu khảo sát IgG (AU/ml) IgM Ứng dụng quy trình 1 4212 71,7 (+) / - 2 7864 487,2 (+) 0,317 (-) - 3 7792 >250 (+) 0,128 (-) (+), Ct=37,3 4 4718 >750 (+) 0,6 (+) (+), Ct=31,78 5 3144 373,5 (+) 0,366 (-) (+), Ct=28,46 6 3162 719,2 (+) 0,226 (-) - 7 5000 217,2 (+) 0,167 (-) - 8 4502 482,1 (+) 0,274 (-) - 9 6996 132,6 (+) 0,133 (-) - 10 6604 750 (+) 0,141 (-) - Bảng 3.19: Kết quả khảo sát mẫu huyết thanh từ BV Từ Dũ và trung tâm y khoa Medic bằng quy trình Real-Time PCR STT Mã số mẫu khảo sát IgG (AU/ml) IgM Ứng dụng quy trình 1 6604 (Từ Dũ) 750 (+) 0,141 (-) (+), Ct=37,4 2 3544 (Từ Dũ) 321 (+) 0,231 (-) (+), Ct=37,2 3 7822 (Từ Dũ) / 0,538 (+) - 4 6514 (Từ Dũ) 376,8 (+) 0,436 (-) - 5 3162 (Từ Dũ) 719,2 (+) 0,226 (-) - 6 2056 (Medic) 1,1U/ml (+) 0,3 (-) - 7 7066 (Medic) 1,2 U/ml (+) 0,6 (-) - 8 7072 (Medic) 0,3 U/ml (-) 2,1 (+) (+), Ct=30,6 9 3207 (Medic) 2,0 U/ml (+) 1,5 ( +) - 10 5089 (Medic) (+), PƯ Real-Time PCR bằng kit ROCHE, 3820 copies. (+), Ct=33,9 Đợt 2, chúng tôi tiếp tục ứng dụng trên 12 mẫu nước tiểu và 12 mẫu máu thu được từ bệnh viện Từ Dũ có kết quả kháng thể CMV (bảng 3.20) Bảng 3.20: Thông tin mẫu bệnh phẩm đợt 2 TT Mẫu Máu Nước tiểu IgG IgM 1 6896 x x 306 (+) 0.106(-) 2 7786 x x 192.9(+) 0.198(-) 3 6746 x x ( Real-Time PCR có Ct=30) 297(+) / 4 6866 x / 98.7(+) 0.198(-) 5 7546 x x 697.2(+) 0.109(-) 6 7068 x x 738.3(+) 0.286(-) 7 7358 x x 171(+) 8 7032 x x 107.1(+) 9 7304 x x 227.7(+) 10 7194 x x 345(+) 0.136(-) 11 7672 x x 335.1(+) 0.193(-) 12 7630 x (Real-Time PCR có Ct=38) x 230.7(+) 0.126(-) Tóm lại,qua khảo sát trên 20 mẫu máu và 22 mẫu nước tiểu được xác định dương tính với kháng thể IgG-CMV, chúng tôi thu được 4 mẫu nước tiểu và 4 mẫu huyết thanh dương tính với phản ứng Real-Time PCR, hai mẫu máu được xác định dương tính với kháng thể IgM-CMV, có một mẫu dương tính với phản ứng Real- Time PCR, chứng tỏ quy trình chúng tôi xây dựng có thể sử dụng chung trên cả dịch máu, hoặc nước tiểu. Tuy nhiên, qua kết quả trên chúng tôi nhận thấy không phải có kháng thể IgG-CMV hay IgM-CMV là có lượng virus trong máu cao đủ để định lượng CMV, giữa hàm lượng kháng thể IgG-CMV hoặc IgM-CMV và hàm lượng virus trong mẫu nhiễm cần nghiên cứu thêm để thấy được mối tương quan của chúng. CHƯƠNG 4 KẾT LUẬN VÀ ĐỀ NGHỊ 4.1. KẾT LUẬN 4.1.1. Chúng tôi đã xây dựng được quy trình xử lý nước tiểu và tách chiết được DNA-CMV trong nước tiểu để định lương virus trong mẫu thử giúp các bác sĩ chẩn đoán bệnh CMV nhanh và điều trị kịp thời. Mặt khác, định lượng DNA-CMV trong nước tiểu còn nhiều ưu điểm: - Thu mẫu đơn giản, đặc biệt hiệu quả đối với em bé mới sinh do việc trích máu rất khó khăn. - Không gây đau và tránh lây nhiễm các bệnh qua đường máu. 4.1.2. Chúng tôi xây dựng được quy trình định lượng CMV bằng Real-Time PCR - Bộ primers – TaqMan probe mẫu chuẩn hoạt động hiệu quả và đặc hiệu. - Nhiệt độ lai của phản ứng là 57,10C. - Nồng độ MgCl2 là 3,5mM. - Nồng độ TaqMan probe là 300nM. - Nồng độ primer là 0,4M. - Hệ số tuyến tính của đường chuẩn là 1,0. - Hệ số biến thiên nội phản ứng : 1,06 – 3,99 - Hệ số biến thiên liên phản ứng : 2,93 – 6,97 - Độ nhạy : 102 bản sao/ phản ứng. - Kết quả phù hợp với phản ứng Real-Time PCR chạy bằng kit của Roche - Ứng dụng quy trình trên bệnh phẩm cho kết quả tốt. Từ đây cho thấy quy trình định lượng CMV của chúng tôi có đủ khả năng ứng dụng để định lượng CMV trong các mẫu máu, hoặc nước tiểu. - Giá thành thấp hơn gấp ba lần so với kit Roche ở trung tâm Y khoa Medic. 4.2. CÁC BƯỚC CƠ BẢN CỦA QUY TRÌNH Hoặc 4.3. ĐỀ NGHỊ Qua phần ứng dụng quy trình chúng tôi đề xuất thêm một số hướng nghiên cứu tiếp tục: 4.3.1. Dùng quy trình định lượng vừa xây dựng thống kê mối tương quan giữa lượng virus trong mẫu thử với biểu hiện bệnh CMV trên bệnh nhân mang thai, sự tương quan giữa dị tật bẩm sinh với lượng virus trong máu, hoặc nước tiểu người mẹ mang thai và những bệnh nhân suy giảm miễn dịch như ghép tạng…. 4.3.2. Ứng dụng quy trình thống kê mối tương quan giữa lượng kháng thể với lượng virus trong máu hoặc nước tiểu liên quan bệnh CMV, so sánh đối chiếu với các phương pháp chẩn đoán khác. THIẾT LẬP VÀ CHẠY PHẢN ỨNG REAL-TIME PCR TÁCH CHIẾT DNA ĐỌC KẾT QUẢ, XÁC ĐỊNH SỐ LƯỢNG COPIES/ml MẪU THỬ THU MẪU HUYẾT THANH THU NƯỚC TIỂU VÀ XỬ LÝ TÀI LIỆU THAM KHẢO Tài liệu tiếng Việt 1. Bio-Rad Laboratories. INC (2004), Hướng dẫn sử dụng real time PCR. 2. Cao Minh Nga (2008), Ứng dụng kỹ thuật sinh học phân tử trong chẩn đoán bệnh nhiễm trùng, tài liệu tập huấn, Bộ Y Tế -Viện Pasteur TP Hồ Chí Minh. 3. Trần Thị Thanh Nga & Cao Minh Nga (3/11/2000), “Vấn đề nhiễm virus trong ghép cơ quan (ghép thận)”, Hội thảo Việt-Pháp về bệnh lý thận và ghép thận ở trẻ em, Tổng hội y dược học TP Hồ Chí Minh, tr.104-111. 4. Đái Duy Ban (2003), Sinh học phân tử của ung thư vòm họng, NXB KHKT. 5. Đặng Văn Giáp (1997), Phân tích dữ liệu khoa học bằng chương trình MS-EXCEL, NXB Giáo dục. 6. Hoàng Ngọc bảo Mi (2005), Xây dựng quy trình phát hiện CMV bằng phương pháp PCR, luận văn tốt nghiệp đại học, trường Đại học Khoa học tự nhiên TP. Hồ Chí Minh. 7. Hồ Huỳnh Thùy Dương (2003), Sinh học phân tử, NXB Giáo dục, tr 129-134. 8. Khuất Hữu Thanh (2006), Cơ sở di truyền phân tử và kỹ thuật gen, NXB KHKT, Hà Nội. 9. Lê Huy Chính, (2007), Vi sinh vật y học, NXB y học, chi nhánh TP Hồ Chí Minh. 10. Quyển Đình Thi, Nông Văn Hải (2008), Những kỹ thuật PCR và ứng dụng phân tích DNA, công nghệ sinh học tập 2, NXB KHTN và công nghệ, Hà Nội. 11. Tạp chí thông tin y dược (22-10-2009), “Cytomegalo virus trong ghép thận”. 12. Tạp chí y học thực hành (2006), “Tìm hiểu Cytomegalovirus”, BS.P.T.H.Q (Dịch), Phòng KHTH - BV Từ Dũ. 13. Tạp chí Y học thực hành (số 11/2007), “CMV não là bệnh thường gặp ở trẻ sơ sinh do nhiễm trùng bẩm sinh từ thời kỳ bào thai”. 14. Từ Thành Trí Dũng (2006), Nhiễm Cytomegalovirus ở bệnh nhân ghép tạng, NXB Y học, chi nhánh TP Hồ Chí Minh. 15. Trịnh Đình Đạt (2006), Công nghệ sinh học tập 4, NXB Giáo dục. TÀI LIỆU THAM KHẢO Tài liệu nước ngoài 16. Angélica Lidia Distéfano, Alicia Alonso, Fabián Martin and Fabián Pardon (2004), “Human Cytomegalovirus: detection of congenital and perinatal infection in Argentina”, BMC Pediatrics, 4:11. 17. A. R. Bergmann et all (2002), “ Importance of Sample Preparation for Molecular Diagnosis of Lyme Borreliosis from Urine”, Journal Of Clinical Microbiology, (Vol. 40, No. 12), p. 4581–4584. 18. Angela M. Kearns et all (2002), “ Rapid detection and quantification of CMV DNA in urine using LightCycler™-based real-time PCR”, Journal of Clinical Virology (24), p 131–134. 19. Ayan K Chakrabarti, Lori Caruso (2009), “ Detection of HIV-1 RNA/DNA and CD4 mRNA in feces and urine”, from chronic HIV-1 infected subjects with and without anti-retroviral therapy 10.1186/ 1742-6405-6-20 (7). 20. Barbi M, Binda S, Primache V, Clerici D (1998), “Congenital cytomegalovirus infection in a northern Italian Region”, Eu J of Epidemiol,p955-960. 21. Bai X, Rogers BB, Harkins PC, Sommerauer J, Squires R, Rotondo K,Quan A, Dawson DB, Scheuermann RH (2000), “Predictive value of quantitative PCR-based viral burden analysis for eight human herpesviruses in pediatric solid organ transplant patients”. J Mol Diagn (2):191–201. 22. Bing-Yuan Chen, Harry W. Janes (2002), “ Methods in Molecular Biology”, PCR Cloning Protocols, Humana Press Inc., Totowa, NJ, vol. 192: pp. 3-16. 23. Boppana SB, Fowler KB, Pass RF, Rivera LB, Bradford RD, Lakeman FD et al (2005), “Congenital cytomegalovirus infection: association between virus burden in infancy and hearing los”s. J Pediatr (146), p817–823. 24. C. Gilbert and G. Boivin (2005), “Human Cytomegalovirus Resistance to Antiviral Drugs”, Antimicrobial agents and chemotherapy, Vol. 49, No. 3, p. 873–883 25. Gault, E., Y. Michel, A. Dehe´e, C. Belabani, J. C. Nicolas, and A. Garbarg-Chenon (2001), “Quantification of human cytomegalovirus DNA by real-time PCR”. J. Clin. Microbiol. (39):772–775. 26. Ghaffari h, Obeidi o, Dehghan m, Chahardouli b, Alimoghaddam k, Gharebaghian a, Shamshiri ar, Ghavamzadeh a. (2006). “Development and evaluation of a real-time taqman- pcr for the detection of human cytomegalovirus dna in bone marrow transplant recipients” , shiraz e-medical journal ,vol 7-. 27. Gouarin S, Gault E, Vabret A, Cointe D, Rozenberg F, Grangeot-Keros L et al (2002). “Realtime PCR quantification of human cytomegalovirus DNA in amniotic fluid samples from mothers with primary infection”. J Clin Microbiol (40):1767–1772. 28. Grefte A. van der Giessen M, Van Son W, ey all (1993). “Circulating cytomegalovirus- infected endothelial cell in patients with an active CMV infection”. J Infect Dis (167), p270- 277. 29. Griscelli, F., M. Barrois, S. Chauvin, S. Lastere, D. Bellet, and J. H. Bourhis (2001), “Quantification of human cytomegalovirus DNA in bone marrow transplant recipients by real-time PCR”. J. Clin. Microbiol (39):4362–4369. 30. Griffiths PD, Baboonian C, Rutter D, Peckham C (1991): “Congenital and maternal cytomegalovirus infections in a London population”. Br J Obstet Gynaecol, 98(2):135-140. 31. Goegebuer .T, B. Van Meensel, K. Beuselinck, V. Cossey, M. Van Ranst, M. Hanssens, and K. Lagrou (Mar. 2009), “Clinical Predictive Value of Real-Time PCR Quantification of Human Cytomegalovirus DNA in Amniotic Fluid Samples”, Journal Of Clinical Microbiology, Vol. 47, No. 3, p. 660–665. 32. Heli Piiparinen (2004), Academicdissertation: Quantitative PCR in the diagnosis and monitoring of Human Cytomegalovirus infection in organ transplant patients. 33. Hidehiro Nishihara a, Masahiro Ito (1994), “ Detection of human cytomegalovirus DNA in immunocompromised children by polymerase chain reaction”, (3), p73-81. 34. Holland, P. M., R. D. Abramson, R. Watson, and D. H. Gelfand (1991). “Detection of specific polymerase chain reaction product by utilizing the 5’-3’ exonuclease activity of Thermus aquaticus DNA polymerase”. Proc. Natl. Acad. Sci. USA (88):7276–7280. 35. Hudson, J. B., M. A. Bedell, D. J. McCance, and L. A. Laiminis (1990),“Immortalization and altered differentiation of human keratinocytes in vitro by the E6 and E7 open reading frames of human papillomavirus type 18”. J. Virol. (64):519–526. 36. Huma Siddiqui, Alexander J. Nederbragt, Kjetill S. Jakobsen (2009) “ A solid-phase method for preparing human DNA from urine for diagnostic purposes”, Clinical Biochemistry (42) , p1128–1135. 37. Isidore Rigoutsos, Jiri Novotny (2003), ”In silico pattern-based analysis of the Human Cytomegalovirus genome”, Journal of virology (84), p17-28. 38. Iwamoto GK, Monick MM, clark BD, et all (1990), “Modulation of interleukin I beta gene expression by the immediate early genes oh human cytomegalovirus”. J Clin Invest (85):p1853-1857. 39. Iwasawa, Akihiko Md; Hiltunen-Back, Eija Md, Reunala, Timo Md; Nieminen, Pekka Md; Paavonen, Jorma Md, (1996), “ Human Papillomavirus DNA in Urine Specimens of Men With Condyloma Acuminatum”. 40. Jayne C.Fox, et al (1995), “Longitudinal analysis of cytomegalovirusload in renal transplant recipients using a quantitative polymerase chain reaction correlation with disease”, Journal of General virology (76):p309-319. 41. Jiska Jebbink, Xin Bai, Beverly Barton Rogers, et all (February 2003), “Development of Real-Time PCR Assays for the Quantitative Detection of Epstein-Barr Virus and Cytomegalovirus, Comparison of TaqMan Probes, and Molecular Beacons”, Journal of Molecular Diagnostics, Vol. (5), No. 1, p15-20. 42. Joeli A. Brinkman a, Meliha Z. Rahmanib, W. Elizabeth Jones b (2004) “Optimization of PCR based detection of human papillomavirus DNA from urine specimens”. Journal of Clinical Virology (29), p 230–240. 43. Joeli A. Brinkman, W. Elizabeth Jones, Ann M. Gaffga, Jonathan A. Sanders, et al (Sept. 2002), “Detection of Human Papillomavirus DNA in Urine Specimens from Human Immunodeficiency Virus-Positive Women”, Journal Of Clinical Microbiology, Vol. 40, No. 9, p. 3155–3161. 44. Kirklin JK, Pillay D, et all (1994) . “Cytomegalovirus after heart transplantation. Riks factors for infection and death : a multi-institutional study”. J Heart Lung Transplant (13):p394-404. 45. Kyeong Man Hong, Hazim Najjar (2004), “Quantitative Real-Time PCR with Automated Sample Preparation for Diagnosis and Monitoring of Cytomegalovirus Infection in Bone Marrow Transplant Patients”, Molecular Diagnostics and Genetics, 846–856. 46. Lo CY, Ho KN, Yuen KY, et all (1997), “Diagnosing cytomegalovirus disease in CMV seropositive renal allograft recipients a comparition between the CMV pp65 assay”. Clin Transplant (11): p286-293. 47. Machida, U., M. Kami, T. Fukui et all (2000), “Real-time automated PCR for early diagnosisand monitoring of cytomegalovirus infection after bone marrow transplantation”. J. Clin. Microbiol. (38): p2536–2542. 48. Marianne Leruez-Ville et all (2003), “Monitoring Cytomegalovirus Infection in Adult and Pediatric Bone Marrow Transplant Recipients by a Real-Time PCR Assay Performed with Blood Plasma”, Journal Of Clinical Microbiology, p. 2040–2046. 49. Mark R Schleiss, MD (18-11-2009), Cytomegalovirus Infection, University of Minnesota Medical School. 50. Matthias J. Reddehase (2009), Cytomegaloviruses, Publisher: Caister Academic Press. 51. Murph JR, Souza IE, Dawson JD, Benson P, Petheram SJ, Pfab D, Gregg A, O'Neill ME, Zimmerman B, Bale JF (1998), “Epidemiology of congenital cytomegalovirus infection: maternal risk factors and molecular analysis of cytomegalovirus strains”, Am J Epidemiol, 147(10):940-947. 52. Michael Boeckh,MeeiLi Huang ( Mar. 2004), “Optimization of Quantitative Detection of Cytomegalovirus DNA in Plasma by Real-Time PCR” , Journal Of Clinical Microbiology, Vol. 42, No. 3, p. 1142–1148. 53. Mori, T., S. Okamoto, et all (2000), “Risk-adapted preemptive therapy for cytomegalovirus disease in patients undergoing allogeneic boNe marrow transplantation”, Bone Marrow Transplant. 25:765–769. 54. Munger, K., and P. M. Howley (2002), “Human papillomavirus immortalization and transformation functions. Virus Res”. (89):213–228. 55. Nada Madi, Widad Al-Nakib, et all (2007), “Detection and Monitoring of Cytomegalovirus Infection in Renal Transplant Patients by Quantitative Real-Time PCR”, Med Princ Pract(16): p268–273. 56. Newton, C.R., Graham, A (1994), PCR, BIOS Scientific Publishers Ltd., Oxford, pp 1– 28. 57. Nitsche, A, N. Steuer, C. A. Schmidt, O. Landt, and W. Siegert (1999). “Different real-time PCR formats compared for the quantitative detection of human cytomegalovirus DNA”. Clin. Chem. (45):p1932–1937. 58. Nitsche, A., N. Steuer, C. A. Schmidt, O. Landt, H. Ellerbrok, G. Pauli, and W. Siegert (2000). “Detection of human cytomegalovirus DNA by real-time quantitative PCR”. J. Clin. Microbiol (38): p2734–2737. 59. Offermanns S, Rosenthal W (2008), “Encyclopedia of Molecular Pharmacology (2nd ed,)”, Springer: 437-438. 60. P. Stanier,et all (1992), “Detection of human cytomegalovi

Các file đính kèm theo tài liệu này:

  • pdfLVSHVSV019.pdf
Tài liệu liên quan