Luận văn Thực trạng chăn nuôi và một số đặc điểm dịch tễ, khả năng đáp ứng miễn dịch của vaccin h5n1 phòng bệnh cúm gia cầm tại Thái Nguyên

Tài liệu Luận văn Thực trạng chăn nuôi và một số đặc điểm dịch tễ, khả năng đáp ứng miễn dịch của vaccin h5n1 phòng bệnh cúm gia cầm tại Thái Nguyên: Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 1 ĐẠI HỌC THÁI NGUYÊN TRƢỜNG ĐẠI HỌC NƠNG LÂM ---------- NGUYỄN THẾ TĨNH THỰC TRẠNG CHĂN NUƠI VÀ MỘT SỐ ĐẶC ĐIỂM DỊCH TỄ, KHẢ NĂNG ĐÁP ỨNG MIỄN DỊCH CỦA VACCIN H5N1 PHÕNG BỆNH CƯM GIA CẦM TẠI THÁI NGUYÊN LUẬN VĂN THẠC SỸ KHOA HỌC NƠNG NGHIỆP Thái Nguyên, năm 2008 Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 2 ĐẠI HỌC THÁI NGUYÊN TRƢỜNG ĐẠI HỌC NƠNG LÂM ---------- NGUYỄN THẾ TĨNH THỰC TRẠNG CHĂN NUƠI VÀ MỘT SỐ ĐẶC ĐIỂM DỊCH TỄ, KHẢ NĂNG ĐÁP ỨNG MIỄN DỊCH CỦA VACCIN H5N1 PHÕNG BỆNH CƯM GIA CẦM TẠI THÁI NGUYÊN CHUYÊN NGÀNH THÚ Y MÃ SỐ 60.62.50 LUẬN VĂN THẠC SỸ KHOA HỌC NƠNG NGHIỆP Hƣớng dẫn khoa học: TS NGUYỄN VĂN QUANG TS HỒNG VĂN DŨNG Thái Nguyên, năm 2008 Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 3 LỜI CAM ĐOAN Tơi xin cam đoan rằng đây là cơng trình nghiên cứu do tơi trực tiếp làm dưới sự hướng dẫn của Tiến sỹ Nguyễn Văn Quang và Tiến sỹ Hồn ...

pdf116 trang | Chia sẻ: hunglv | Ngày: 29/05/2014 | Lượt xem: 882 | Lượt tải: 0download
Bạn đang xem nội dung tài liệu Luận văn Thực trạng chăn nuôi và một số đặc điểm dịch tễ, khả năng đáp ứng miễn dịch của vaccin h5n1 phòng bệnh cúm gia cầm tại Thái Nguyên, để tải tài liệu về máy bạn click vào nút DOWNLOAD ở trên
Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 1 ĐẠI HỌC THÁI NGUYÊN TRƢỜNG ĐẠI HỌC NƠNG LÂM ---------- NGUYỄN THẾ TĨNH THỰC TRẠNG CHĂN NUƠI VÀ MỘT SỐ ĐẶC ĐIỂM DỊCH TỄ, KHẢ NĂNG ĐÁP ỨNG MIỄN DỊCH CỦA VACCIN H5N1 PHÕNG BỆNH CƯM GIA CẦM TẠI THÁI NGUYÊN LUẬN VĂN THẠC SỸ KHOA HỌC NƠNG NGHIỆP Thái Nguyên, năm 2008 Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 2 ĐẠI HỌC THÁI NGUYÊN TRƢỜNG ĐẠI HỌC NƠNG LÂM ---------- NGUYỄN THẾ TĨNH THỰC TRẠNG CHĂN NUƠI VÀ MỘT SỐ ĐẶC ĐIỂM DỊCH TỄ, KHẢ NĂNG ĐÁP ỨNG MIỄN DỊCH CỦA VACCIN H5N1 PHÕNG BỆNH CƯM GIA CẦM TẠI THÁI NGUYÊN CHUYÊN NGÀNH THÚ Y MÃ SỐ 60.62.50 LUẬN VĂN THẠC SỸ KHOA HỌC NƠNG NGHIỆP Hƣớng dẫn khoa học: TS NGUYỄN VĂN QUANG TS HỒNG VĂN DŨNG Thái Nguyên, năm 2008 Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 3 LỜI CAM ĐOAN Tơi xin cam đoan rằng đây là cơng trình nghiên cứu do tơi trực tiếp làm dưới sự hướng dẫn của Tiến sỹ Nguyễn Văn Quang và Tiến sỹ Hồn Văn Dũng. Các số liệu và kết quả trình bầy trong luận văn này là hồn tồn trung thực, được rút ra từ tình hình thực tế hiện nay tại tỉnh Thái Nguyên và chưa hề được sử dụng để bảo vệ một học vị nào. Mọi sự giúp đỡ cho việc hồn thành luận văn này đều đã được cảm ơn. Các thơng tin và tài liệu trình bầy trong luận văn này đều được chỉ rõ nguồn gốc. Tác giả Nguyễn Thế Tĩnh Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 4 LỜI CẢM ƠN Sau thời gian dài học tập và nghiên cứu, với sự nỗ lực của bản thân cùng với sự hướng dẫn và giúp đỡ quý báu của các Thầy cơ giáo, các bạn bè đồng nghiệp, đến nay đề tài nghiên cứu của tơi đã hồn thành. Nhân dịp này, tơi xin bày tỏ lịng kính trọng sâu sắc và vơ cùng biết ơn tới hai người Thầy hướng dẫn khoa học: TS Nguyễn Văn Quang - Trưởng khoa Chăn nuơi Thú y - Trường Đại Học Nơng Lâm Thái Nguyên. TS Hồng Văn Dũng - Chi cục trưởng Chi cục Thú y tỉnh Thái Nguyên. Những người Thầy uyên bác, mẫu mực, tận tình và chu đáo đã luơn cổ vũ, động viên, hướng dẫn và chỉ bảo giúp tơi trong suốt quá trình nghiên cứu và hồn thành luận văn này. Tơi cũng xin bày tỏ lịng biết ơn tới tập thể Cán bộ Cơng chức của Chi cục Thú y tỉnh Thái Nguyên và Trạm Thú y huyện Định Hố, Trạm Thú y Thành phố Thái Nguyên, Trạm Thú y huyện Phú Bình đã luơn cộng tác và giúp đỡ tơi trong suốt quá trình thực hiện đề tài nghiên cứu của mình. Xin trân trọng cảm ơn tập thể Cán bộ Cơng chức của Viện Thú y Quốc Gia và Trung tâm Chẩn đốn Thú y Trung Ương nơi tơi phân tích mẫu đã cộng tác giúp đỡ tơi trong quá trình nghiên cứu đề tài này. Xin gửi lời cảm ơn sâu sắc tới tập thể Cán bộ Cơng chức Khoa Chăn nuơi Thú y, Khoa Sau Đại Học - Trường Đại Học Nơng Lâm Thái Nguyên đã giúp đỡ tơi trong suốt thời gian học tập và nghiên cứu của mình. Tơi xin trân thành cảm ơn các bạn bè đồng nghiệp gần xa và những người thân trong gia đình đã cùng chung lo và luơn cổ vũ động viên tơi hồn thành tốt cơng trình nghiên cứu khoa học này. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 5 Với những kiến thức ít ỏi của bản thân cùng với những yêu cầu rất lớn của đề tài, đặc biệt là nội dung nghiên cứu cịn khá mới mẻ ở nước ta hiện nay nên trong quá trình nghiên cứu và những kết quả thu được của đề tài ắt hẳn cịn nhiều thiếu sĩt. Kính mong các Thầy cơ giáo, các Nhà khoa học và các bạn bè đồng nghiệp tham gia đĩng gĩp ý kiến để đề tài của tơi được hồn chỉnh hơn. Tơi xin trân trọng cảm ơn ! Tác giả Nguyễn Thế Tĩnh Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 6 CÁC CHỮ VIẾT TẮT HPAI Hight Pathogenic Avian Influenza. LPAI Low Pathogenic Avian Influenza. n Số mẫu. < Nhỏ hơn. > Lớn hơn. ≥ Lớn hơn hoặc bằng. ≤ Nhỏ hơn hoặc bằng. (+) Dương tính. (%) Tỷ lệ phần trăm. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 7 DANH MỤC CÁC BẢNG Bảng 3.1. Tình hình chăn nuơi gia cầm ở một số huyện, thành của tỉnh Thái Nguyên 46 Bảng 3.2. Quy mơ đàn gà nuơi trong các nơng hộ. 48 Bảng 3.3. Quy mơ đàn vịt nuơi trong các nơng hộ. 49 Bảng 3.4. Quy mơ đàn ngan nuơi trong các nơng hộ. 50 Bảng 3.5. Tỷ lệ hộ nuơi gà ở các phương thức nuơi. 52 Bảng 3.6. Tỷ lệ hộ nuơi vịt và ngan ở các phương thức nuơi. 53 Bảng 3.7. Tỷ lệ hộ nuơi gà cĩ tiêm phịng một số bệnh chính. 56 Bảng 3.8. Tỷ lệ hộ nuơi vịt cĩ tiêm phịng một số bệnh chính. 58 Bảng 3.9. Tỷ lệ hộ nuơi ngan cĩ tiêm phịng một số bệnh chính. 60 Bảng 3.10. Tỷ lệ gia cầm được kiểm tra trong giết mổ và lưu thơng. 62 Bảng 3.11. Tỷ lệ xuất hiện bệnh cúm theo loại gia cầm. 66 Bảng 3.12. Tỷ lệ xuất hiện bệnh cúm theo phương thức chăn nuơi. 68 Bảng 3.13. Tỷ lệ xuất hiện bệnh cúm ở gia cầm theo quy mơ đàn nuơi 69 Bảng 3.14. Tỷ lệ phát hiện mẫu huyết thanh cĩ kháng thể H5 ở gia cầm chưa tiêm phịng theo đàn và theo cá thể. 72 Bảng 3.15. Tỷ lệ phát hiện kháng thể cúm H5 ở cá thể gia cầm theo phương thức chăn nuơi. 73 Bảng 3.16. Tỷ lệ phát hiện kháng thể cúm H5 ở đàn gia cầm chưa tiêm phịng theo phương thức chăn nuơi. 75 Bảng 3.17. Tỷ lệ phát hiện virus cúm H5 trong mẫu swab của gia cầm nuơi tại Thái Nguyên. 76 Bảng 3.18. Tỷ lệ phát hiện virus cúm H5 trong mẫu swab của gia cầm theo phương thức chăn nuơi. 78 Bảng 3.19. Tỷ lệ phát hiện kháng thể ở gà sau khi tiêm vaccin H5N1 21 ngày theo đàn và theo cá thể. 81 Bảng 3.20. Hiệu giá kháng thể ở gà sau tiêm vaccin H5N1 21 ngày. 83 Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 8 Bảng 3.21. Khả năng bảo hộ đàn gà chống cúm của vaccin H5N1. 84 Bảng 3.22. Tỷ lệ phát hiện kháng thể ở vịt sau khi tiêm vaccin H5N1 21 ngày theo đàn và theo cá thể. 86 Bảng 3.23. Hiệu giá kháng thể ở vịt sau khi tiêm vaccin H5N1 21 ngày. 87 Bảng 3.24. Khả năng bảo hộ đàn vịt chống cúm của vaccin H5N1. 89 Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 9 DANH MỤC CÁC ẢNH Ảnh 1. Tiêu bản mẫu swab âm tính. 77 Ảnh 2. Tiêu bản mẫu swab dương tính. 77 Ảnh 3. Lấy mẫu huyết thanh của vịt. 104 Ảnh 4. Lấy mẫu huyết thanh của gà. 104 Ảnh 5. Lấy mẫu huyết thanh của gà. 105 Ảnh 6. Lấy mẫu huyết thanh của ngan. 105 Ảnh 7. Tiêm phịng cúm H5N1 cho vịt. 106 Ảnh 8. Tiêm phịng cúm H5N1 cho gà. 106 Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 10 CƠNG TRÌNH KHOA HỌC ĐƢỢC CƠNG BỐ CỦA ĐỀ TÀI Tên cơng trình: “Lưu hành virus cúm và đáp ứng miễn dịch vacxin phịng cúm của gia cầm tỉnh Thái Nguyên”. Tên tác giả: Nguyễn Thế Tĩnh, Nguyễn Văn Quang, Hồng Văn Dũng. Cơng trình đã được duyệt và sẽ đăng trên Tạp chí khoa học kỹ thuật thú y số 4/2008 (cĩ giấy xác nhận của Ban biên tập kèm theo). Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 11 MỞ ĐẦU 1. Tính cấp thiết của đề tài Bệnh cúm gia cầm (Avian Influenza) là bệnh truyền nhiễm cực kỳ nguy hiểm do virus cúm type A, thuộc họ Orthomyxoviridae gây ra cho các lồi lơng vũ như gà, vịt, ngan, ngỗng, đà điểu, các lồi chim, một số động vật cĩ vú và con người. Bệnh cĩ khả năng lây lan rất nhanh và mạnh. Thời gian ủ bệnh trung bình từ vài giờ đến 3 ngày. Triệu chứng lâm sàng biểu hiện ở nhiều dạng khác nhau, cĩ dạng tỷ lệ chết rất cao, cĩ dạng khơng biểu hiện triệu chứng và tỷ lệ chết cĩ thể lên đến 100% số gia cầm mắc bệnh (Horimoto, 2001) [43]. Những năm gần đây, bệnh liên tục bùng phát ở nhiều địa phương trong cả nước với nhiều quy mơ khác nhau, trong đĩ cĩ tỉnh Thái Nguyên, đã làm chết và tiêu hủy hàng triệu con gia cầm các loại, gây thiệt hại rất lớn về kinh tế và ảnh hưởng đến sự phát triển của ngành chăn nuơi gia cầm. Đồng thời gây lo lắng cho cộng đồng về nguy cơ lây nhiễm dịch cúm A – H5N1 ở người. Nhiều tác giả cho rằng, sự xuất hiện của bệnh cĩ liên quan và ảnh hưởng rất lớn từ phương thức chăn nuơi và cơng tác vệ sinh thú y trong giết mổ và lưu thơng gia cầm. Để tìm hiểu tình hình thực tế ở địa phương nhằm gĩp phần nâng cao hiệu quả cho cơng tác phịng chống dịch cúm gia cầm, chúng tơi đã tiến hành nghiên cứu đề tài: “Thực trạng chăn nuơi và một số đặc điểm dịch tễ, khả năng đáp ứng miễn dịch của vacxin H5N1 phịng bệnh cúm gia cầm tại Thái Nguyên”. 2. Mục tiêu của đề tài - Đánh giá về thực trạng chăn nuơi, lưu thơng giết mổ gia cầm ở một số huyện thành của tỉnh Thái Nguyên. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 12 - Tình hình dịch cúm gia cầm ở Thái Nguyên từ năm 2004 đến nay. - Sự lưu hành virus cúm trên đàn gia cầm tại tỉnh Thái Nguyên. - Xác định hiệu giá kháng thể ở gà và vịt sau tiêm phịng vaccin H5N1 (Trung Quốc). 3. Ý nghĩa khoa học và thực tiễn của đề tài - Đánh giá về thực trạng chăn nuơi, lưu thơng và giết mổ gia cầm và ảnh hưởng của nĩ đến cơng tác phịng chống dịch cúm tại Thái Nguyên. - Bổ sung một số đặc điểm dịch tễ của bệnh cúm gia cầm. - Xác định tỷ lệ lưu hành virus cúm trên đàn gia cầm ở Thái Nguyên. - Đánh giá đáp ứng miễn dịch sau khi tiêm vaccin phịng cúm H5N1 của gia cầm ở tỉnh Thái Nguyên. - Đề xuất những giải pháp thực tế nhằm hạn chế sự tái bùng phát và lây lan dịch bệnh cúm trên đàn gia cầm của tỉnh Thái Nguyên nĩi riêng cũng như các tỉnh miền núi phía Bắc nĩi chung. 4. Địa điểm nghiên cứu - Các cơ sở và hộ chăn nuơi gia cầm của tỉnh Thái Nguyên. - Chi cục Thú y Thái Nguyên. - Viện Thú y Quốc gia. - Trung tâm Chẩn đốn Thú y Trung Ương. 5. Thời gian nghiên cứu đề tài - Từ tháng 1 năm 2007 đến ngày 15 tháng 2 năm 2008. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 13 Chƣơng 1 TỔNG QUAN TÀI LIỆU 1.1. Tình hình chăn nuơi gia cầm ở Thái Nguyên và định hƣớng phát triển trong thời gian tới 1.1.1. Tình hình chăn nuơi gia cầm những năm qua Theo niên giám của Cục thống kê Thái Nguyên thì năm 2005, tồn tỉnh cĩ 180 xã, phường, thị trấn, 2.370 thơn xĩm, khoảng 231.392 hộ và trên 80% số hộ cĩ chăn nuơi gia cầm. Tổng đàn gia cầm là 4.669.374 con, trong đĩ cĩ 3.858.317 con gà, 811.057 con vịt, ngan và ngỗng. Cĩ khoảng 86 trang trại chăn nuơi gia cầm tập trung với quy mơ từ 500 con gia cầm trở lên bằng 3,7%, trong đĩ cĩ 20 trang trại chăn nuơi với quy mơ từ 6.000 – 8.000 con gia cầm một lứa, cịn lại hầu hết là chăn nuơi nhỏ lẻ, thủ cơng thuộc các nơng hộ. Tại thời điểm ngày 1 tháng 8 năm 2007, tổng đàn gia cầm của tỉnh Thái Nguyên là 5.070.959 con, trong đĩ cĩ 4.196.808 con gà chiếm 82,8%, 874.151 con vịt và ngan bằng 17,2%. Cĩ khoảng 231.403 hộ trong đĩ cĩ khoảng 80% số hộ cĩ chăn nuơi gia cầm và cĩ khoảng trên 200 hộ và trang trại chăn nuơi với quy mơ trên 500 con bằng khoảng 8,6%, chủ yếu ở Thành phố Thái Nguyên và các huyện phía Nam như Phổ Yên, Sơng Cơng, Phú Bình và một số huyện khác như Phú Lương, Đồng Hỷ …. Tổng đàn gia cầm lớn nhất là ở huyện Phú Bình với 1.099.022 con, tiếp theo là huyện Phổ Yên với 747.093 con và thấp nhất là ở Thị xã Sơng Cơng với 268.670 con. Riêng Thành phố Thái Nguyên cĩ 538.218 con và huyện Định Hố cĩ 691.528 con. Trong khi ở nước ta, tổng đàn gia cầm trước dịch cúm gia cầm cuối năm 2003 là 254,06 triệu con nhưng sang năm 2004, sau khi dịch cúm gia cầm xảy ra thì tổng đàn gia cầm đã giảm đi 14,23% và chỉ cịn 218,15 triệu con. Trong đĩ miền Nam giảm 25,69% và miền Bắc giảm 6,43%. Trong khoảng 80% hộ Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 14 nơng dân chăn nuơi gia cầm thì cĩ 15% nuơi theo phương thức nuơi nhốt, 20% nuơi theo phương thức bán chăn thả và 65% nuơi theo phương thức chăn thả tự do (Hồng Kim Giao và Nguyễn Thanh Sơn, 2005) [13]. 1.1.2. Định hướng phát triển trong thời gian tới Những năm qua, do ảnh hưởng của dịch cúm nên ngành chăn nuơi gia cầm ở Thái Nguyên được quan tâm hơn từ các ban ngành chức năng và chính quyền các cấp cũng như người chăn nuơi. Những năm trước dịch cúm, ngành chăn nuơi gia cầm vẫn chủ yếu là nhỏ lẻ, thủ cơng và chăn thả tự do trong các nơng hộ thì từ năm 2005 đến nay ngành chăn nuơi gia cầm đang chuyển dần sang chăn nuơi theo quy mơ nuơi nhốt, mặc dù cịn chậm nhưng cũng rất đáng khích lệ. Theo kế hoạch phát triển chăn nuơi gia cầm năm 2004 – 2005 của tỉnh Thái Nguyên là chuyển dịch cơ cấu và quy mơ chăn nuơi theo hướng tập trung, giảm tỷ lệ chăn nuơi nhỏ lẻ và thủ cơng, xây dựng vùng và cơ sở chăn nuơi an tồn sinh học nhằm kiểm sốt và khống chế được dịch cúm gia cầm. Phấn đấu đến năm 2005 khơi phục lại sự phát triển của ngành chăn nuơi gia cầm đặc biệt là chăn nuơi gà. Mục tiêu phát triển giai đoạn 2006 - 2010 là phấn đấu đạt tỷ trọng sản xuất chăn nuơi gia cầm hàng hố theo quy mơ trang trại, gia trại chiếm khoảng trên 30%. Phấn đấu đạt tốc độ tăng trưởng số đầu con từ 7 – 7,5%, trong đĩ đối với gà là khoảng từ 9,5 – 10% và vịt ngan từ 4,5 – 5%. Tổng số đàn gia cầm đến năm 2010 là khoảng 6.980.000 con, trong đĩ gà là 5.780.000 con và vịt ngan là 1.200.000 con. Phấn đấu kiểm sốt được dịch cúm gia cầm. Quy hoạch và kiểm sốt các cơ sở giống gia cầm, chăn nuơi gia cầm tập trung như trang trại cơng nghiệp và bán cơng nghiệp cho các địa phương mang tính hàng hố theo hướng an tồn sinh học. Quy hoạch và xây dựng các cơ sở giết mổ và chế biến gia cầm tập trung cũng như chợ đầu mối cho các huyện, thành, thị. Kiểm sốt chặt chẽ việc kinh Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 15 doanh, lưu thơng và giết mổ. Động viên và khuyến khích người chăn nuơi và các cơ sở chăn nuơi gia cầm đăng ký sản xuất giống, đăng ký tiêu chuẩn chất lượng và thương hiệu giống của cơ sở mình sản xuất và kinh doanh. Tổ chức lại thị trường tiêu thụ gia cầm và nâng cao ý thức của người dân trong việc sử dụng thực phẩm an tồn dịch bệnh. Nâng cao tỷ lệ tiêm phịng một số bệnh cho đàn gia cầm, đối với bệnh cúm gia cầm phải tiêm phịng triệt để số gia cầm trong diện tiêm. Tăng cường và thực hiện nghiêm ngặt cơng tác vệ sinh sát trùng tiêu độc. Thường xuyên kiểm tra phát hiện dịch bệnh, bao vây, khống chế và dập tắt dịch bệnh ngay khi dịch xảy ra …. 1.1.3. Một số giống gia cầm và phương thức chăn nuơi phổ biến ở Thái Nguyên Qua quá trình điều tra và thực hiện đề tài, chúng tơi nhận thấy, đàn gia cầm ở Thái Nguyên hiện nay là rất phong phú về giống lồi gia cầm. Trong số các lồi gia cầm phổ biến hiện nay thì gà chiếm đa số với nhiều giống khác nhau, chủ yếu và phổ biến nhất vẫn là các giống gà địa phương như gà ri, gà chọi, gà hồ …. Các giống gà nhập nội như gà sao, gà lương phượng, gà ai cập và một số giống gà khác nhưng số lượng khơng nhiều. Một số giống vịt phổ biến hiện nay như vịt cỏ, vịt siêu trứng, vịt khoang tầu, vịt bơ … trong đĩ vịt khoang tầu và vịt bơ chiếm đa số do cĩ trọng lượng lớn và khả năng tăng trưởng nhanh, cịn các giống vịt khác như vịt bầu bến, vịt bầu quỳ gần như khơng cịn. Đối với đàn ngan thì hiện nay chủ yếu và khá phổ biến là giống ngan pháp, các giống như ngan sen, ngan trâu, ngan ré mặc dù cĩ khả năng chống chịu bệnh tật tốt hơn nhưng khả năng tăng trưởng chậm và trọng lượng thấp nên hiện nay hầu như khơng cịn phổ biến. Cũng giống như nhiều địa phương khác trong cả nước, ở Thái Nguyên hiện nay ngành chăn nuơi gia cầm phổ biến ở 3 phương thức chăn nuơi chính Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 16 là nuơi nhốt, nuơi bán chăn thả và nuơi chăn thả. Trong đĩ ở chăn nuơi gà thì vẫn phổ biến ở cả 3 phương thức chăn nuơi nĩi trên và chủ yếu là chăn thả tự do với khoảng 50%, ít nhất là ở phương thức nuơi nhốt tập trung cơng nghiệp và bán cơng nghiệp với chỉ khoảng 18 – 34%. Cịn ở vịt và ngan hiện nay chỉ cịn phổ biến ở ở phương thức nuơi nhốt và nuơi bán chăn thả nhưng chủ yếu là nuơi nhốt với khoảng trên 80% ở ngan và 60% ở vịt. Đối với quy mơ đàn nuơi hiện nay thì đã tăng dần cả về số đầu con và quy mơ nuơi nhốt so với những năm trước đây khi chưa xảy ra dịch cúm gia cầm. Ở quy mơ chăn nuơi từ 200 con trở lên đã chiếm khoảng 17 – 20% ở gà và từ 7 – 9% ở vịt và ngan. Những quy mơ chăn nuơi này chủ yếu tập trung ở Thành phố Thái Nguyên, Đồng Hỷ, Phú Lương và các huyện phía Nam như Phổ Yên, Sơng Cơng và Phú Bình. Cịn lại vẫn chủ yếu là chăn nuơi nhỏ lẻ và thủ cơng tại các nơng hộ dải rác khắp các thơn xĩm trong tỉnh. 1.2. Những hiểu biết chung về bệnh cúm gia cầm 1.2.1. Sơ lược về lịch sử phát triển của bệnh Bệnh cúm gia cầm (Avian Influenza) trong lịch sử cịn cĩ tên gọi là Fowl Plague, đã được Porroncito mơ tả lần đầu tiên ở Italia vào năm 1878 và Ơng nhận định một cách sáng suốt rằng tương lai nĩ sẽ là một bệnh quan trọng và nguy hiểm. Nhưng sau đĩ 23 năm, năm 1901 Centai và Savunozzi mới xác định được căn nguyên siêu nhỏ (Filterable agent) là yếu tố gây bệnh. Từ đĩ, mãi đến năm 1955 virus gây bệnh mới được Achafer xác định virus thuộc type A thơng qua kháng nguyên bề mặt H7N1 và H7N7. Bệnh được Beard.C.W mơ tả khá kỹ ở Mỹ vào năm 1971 qua đợt dịch trên gà tây. Những năm tiếp theo, bệnh được phát hiện ở Nam Mỹ, Bắc Mỹ, Nam Phi, Trung cận Đơng, Châu Âu, Vương Quốc Anh và Liên Xơ cũ. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 17 Các cơng trình nghiên cứu cĩ hệ thống và chi tiết về bệnh này cũng lần lượt được cơng bố ở nhiều nơi trên Thế giới như Úc năm 1975, Anh năm 1979, Mỹ năm 1983 – 1984, AiLen năm 1983 – 1984 và nhiều Quốc gia khác. Việc các vụ dịch liên tục bùng nổ ở khắp các Châu lục trên Thế giới đã thơi thúc Hiệp hội các nhà chăn nuơi gia cầm tổ chức Hội thảo lần đầu tiên vào năm 1981 về chuyên đề Bệnh Cúm Gà. Hội thảo tiếp tục được tổ chức lần hai tại Ailen năm 1987 và lần ba cũng tại Ailen năm 1992. Từ đĩ đến nay bệnh ngày càng xảy ra với quy mơ lớn hơn và nguy hiểm hơn nên luơn được coi là một trong những nội dung đặc biệt quan trọng trong các Hội nghị về dịch tễ ở khắp nơi trên Thế giới. Bệnh được tổ chức Dịch tễ Thế giới (OIE) liệt vào danh sách một trong bốn bệnh đỏ đặc biệt nguy hiểm đối với ngành chăn nuơi trên tồn Thế giới do bệnh ngày càng trở nên phổ biến và gây thiệt hại lớn về kinh tế cho người chăn nuơi đồng thời làm chết nhiều gia cầm và hạn chế thương mại giữa các nước. Đặc biệt nguy hiểm là bệnh cĩ khả năng lây nhiễm sang con người và cả một số lồi động vật cĩ vú khác như lợn, hải cẩu, cầy hương. Tại Pakistan tháng 10/1994, Newe.C.W và cộng sự đã cơng bố dịch cúm do virus H7 gây ra ở gà từ 7-66 tuần tuổi, làm chết 63% gà trong ổ dịch. Năm 1997, dịch cúm gia cầm xảy ra tại Hồng Kơng – Trung Quốc cĩ thể coi là một đại dịch trong chăn nuơi gia cầm và gây thiệt hại to lớn về mọi mặt cho đặc khu này với hàng chục người bị tử vong do dịch cúm gà. Cũng như vậy, tại Italia năm 2001 đã cĩ gần 400 cơ sở chăn nuơi gia cầm bị dịch, làm chết và tiêu huỷ 14 triệu con gia cầm các loại. 1.2.2. Tình hình bệnh cúm gia cầm * Tình hình trong nước Tại Việt Nam, dịch cúm gia cầm xuất hiện lần đầu tiên vào cuối tháng 12 năm 2003 tại tỉnh Hà Tây, Tiền Giang, Long An sau đĩ nhanh chĩng phát Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 18 tán và lây lan ra các tỉnh thành khác với diễn biến hết sức phức tạp. Ngay trong đợt dịch này (từ tháng 12/2003 đến ngày 27/02/2004), bình quân mỗi ngày cĩ khoảng 150 – 230 xã của 15 – 20 huyện phát sinh ổ dịch mới thuộc 57 tỉnh thành trong cả Nước, làm chết và tiêu huỷ hàng ngày từ 2 – 3 triệu con gia cầm các loại, cĩ ngày lên tới 4 triệu con (Cục Thú y, 2004) [6]. Tổng số xã, phường cĩ dịch là 2.574 (chiếm 24,6% số xã phường trong cả nước) thuộc 381 quận, huyện, thị xã (chiếm 60%), số gia cầm chết và tiêu huỷ là 43,9 triệu con, chiếm 16,79% tổng đàn, trong đĩ gà chiếm 30,4 triệu con, thuỷ cầm chiếm 13,5 triệu con, ngồi ra cịn cĩ 14,76 triệu con chim cút và các loại chim khác bị chết và tiêu huỷ (Phạm Sỹ Lăng, 2005) [16]. Thiệt hại ước tính khoảng 1.300 tỷ đồng (Nguyễn Tiến Dũng, 2006) [12] Dịch tái phát đợt hai từ tháng 4 – 11 năm 2004 ở 46 xã, phường tại 32 quận, huyện, thị xã thuộc 17 tỉnh thành, làm chết và tiêu huỷ 84.078 con, trong đĩ 55.999 con gà, 8.132 con vịt và 19.947 con chim cút (Phạm Sỹ Lăng, 2005) [16]. Đợt ba dịch tái phát từ tháng 12 năm 2004 đến tháng 6 năm 2005 ở 15 tỉnh phía Bắc và 21 tỉnh phía Nam với 670 xã, 182 huyện, tiêu huỷ 1.847.213 con (Trần Cơng Xuân và cộng sự, 2005) [30]. Từ đầu tháng 10 năm 2005 đến ngày 25 tháng 12 năm 2005 dịch đã tái phát và xuất hiện ở 285 xã phường của 100 huyện thuộc 24 tỉnh thành. Tổng số gia cầm chết và tiêu huỷ là 3.735.620 con gia cầm các loại. Đến ngày 08 tháng 01 năm 2006 tất cả các tỉnh thành trong cả Nước đã tạm thời khống chế được dịch (Tơ Long Thành, 2006) [27]. Sau gần một năm Việt Nam khơng cĩ dịch thì ngày 6 tháng 12 năm 2006 dịch cúm gia cầm lại tái phát trở lại ở các địa phương thuộc hai tỉnh là Bạc Liêu và Cà Mau, đưa Việt Nam trở thành nước lần thứ tư xuất hiện dịch (Lê Văn Năm, 2007) [21]. Sau đĩ phát tán và lây lan ra 9 tỉnh thành khác, đã cĩ 83 xã phường của 33 quận huyện thuộc 11 tỉnh thành. Tổng số gia cầm Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 19 mắc bệnh, chết và tiêu huỷ là 103.094 con, trong đĩ cĩ 13.622 con gà và 89.472 con vịt ngan. Dịch xảy ra ở quy mơ nhỏ lẻ, chủ yếu ở vịt dưới 3 tháng tuổi do ấp nở gia cầm trái phép chưa được tiêm vaccin, ngồi Cà Mau và Bạc Liêu thì hầu hết các tỉnh chỉ xảy ra ổ dịch ở quy mơ rất nhỏ (1 hoặc 2 hộ) nên đã ngay lập tức được dập tắt. Đợt 2, dịch xảy ra vào tháng 5 năm 2007 tại Nghệ An rồi lây lan ra 167 xã phường của 70 quận huyện, thuộc 23 tỉnh thành, làm chết và tiêu huỷ 294.849 con gia cầm, trong đĩ cĩ 21.525 con gà bằng 7,31%, 264.549 con vịt bằng 89,71% và 8.775 con ngan bằng 2,98%. Nặng nhất là Nam Định với 26 xã phường thuộc 6 huyện thành và Nghệ An 26 xã phường thuộc 5 huyện thành. Riêng tỉnh Đồng Tháp, dịch đã 3 lần xuất hiện trên đàn gia cầm (Bộ Nơng nghiệp và phát triển nơng thơn, 2007) [3]. Năm 2008, chỉ tính đến tháng 2 đã cĩ 17 tỉnh thành trong cả nước xuất hiện dịch, làm chết hàng triệu con gia cầm. * Tình hình dịch cúm tại Thái Nguyên Riêng tỉnh Thái Nguyên, đến nay dịch cúm gia cầm đã 4 lần xuất hiện và ở những quy mơ khác nhau. Lần đầu tiên vào ngày 27 tháng 01 năm 2004 tại xã Kha Sơn, huyện Phú Bình sau đĩ lây lan rất nhanh ra 8/9 huyện thành thị trong tỉnh, với tổng số 1.258 hộ cĩ dịch, thuộc 163 xĩm ở 48 xã. Làm chết và tiêu huỷ 172.288 con gia cầm các loại chiếm 3,58% so với tổng đàn và 13.760 quả trứng. Ngày 08/4/2004 tỉnh Thái Nguyên đã cơng bố hết dịch cúm gia cầm trên địa bàn tồn tỉnh. Năm 2005 dịch đã tái phát trở lại ở tỉnh Thái Nguyên với 5 điểm cĩ dịch thuộc 5 xĩm ở 5 xã tại hai huyện là Phú Lương và Thị xã Sơng Cơng. Làm chết và tiêu huỷ 12.513 con gia cầm các loại. Đến ngày 17/12/2005 dịch cúm đã được khống chế trên địa bàn tồn tỉnh. Từ đĩ đến tháng 7 năm 2007, do làm tốt cơng tác phịng chống và tiêm phịng vaccin nên dịch cúm gia cầm đã tạm thời được khống chế, đặc biệt là năm 2006 dịch đã khơng xuất hiện trở lại trên địa bàn tỉnh Thái Nguyên. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 20 Năm 2007, dịch xuất hiện trở lại ở Thái Nguyên vào ngày 23 tháng 8 tại gia đình Bà Nguyễn Thị Nga – xĩm Phú Thịnh – Xã Thuận Thành - huyện Phổ Yên với tổng đàn cĩ gia cầm mắc bệnh, ốm, chết và tiêu huỷ là 185 con, trong đĩ gồm 150 con vịt và 35 con gà. Những ngày đầu năm 2008 (từ 1/1 đến 15/2) dịch đã xảy ra tại 5 hộ và 1 trại gà tại Thành phố Thái Nguyên và Thị xã Sơng Cơng với 5 ổ dịch thuộc 4 xã phường, tổng số gia cầm chết và tiêu huỷ là 5.789 con, trong đĩ cĩ 4.228 con gà, 834 con vịt, 725 con ngan và 2 con gia cầm khác. 1.2.3. Căn nguyên gây bệnh * Đặc điểm về hình thái, cấu tạo và kích thước Virus gây bệnh cúm gia cầm cĩ tên khoa học là Influenza virus, thuộc họ Orthomyxovirus, là họ virus đa hình thái, cĩ vỏ ngồi, genom là ARN sợi đơn, âm, phân đoạn (Swayne D.E, Suarez D.L, 2000) [48]. Trước đây, các virus Orthomyxo và Paramyxo đều được xếp chung vào một họ là Myxoviridae do chúng cĩ cấu trúc và khả năng gây bệnh giống nhau, nhưng về sau được tách thành hai họ riêng là Orthomyxoviridae và Paramyxoviridae do phát hiện thấy chúng cĩ nhiều đặc điểm cơ bản khơng giống nhau. Chữ “myxo” cĩ nghĩa là chất nhầy, nguồn gốc của phần này là do phần ngồi của protein của virus cĩ mang các loại đường và phần ngọn của các mạch nối đường chính là một loại acid: Acid Sialic hay cịn gọi là acid neuraminidic. Chữ “ortho” cĩ nghĩa là chính thống, nĩi lên loại myxovirus được phát hiện và đặt tên trước. Cĩ ba type virus cúm được ký hiệu là A, B và C được phân biệt với nhau qua bản chất kháng nguyên NP (Nucleoprotein) và M (Matric antigen). Type A gây cúm ở tất cả các lồi gia cầm, type B và C gây cúm điển hình ở người và động vật (Lê Văn Năm, 2004) [18]. Tuy nhiên các nhà nghiên cứu cũng đã tìm thấy virus cúm type A ở người, lợn, ngựa và một số động vật cĩ Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 21 vú khác. Theo Nguyễn Tiến Dũng (2006) [12] thì virus cúm thuộc họ Orthomyxoviridae được chia làm 5 giống khác nhau dựa trên cấu trúc kháng nguyên của hai loại protein NP và M, đĩ là Influenza A, Influenza B, Influenza C, Thogotovirus và Isavirus. Virus cúm cĩ kích thước trung bình, đường kính 80-120nm, dài 200- 300nm, trọng lượng phân tử 4,6 – 6,4dal, trên kính hiển vi điện tử tương phản âm cĩ dạng gần như hình cầu hoặc hạt mỏng, một số ít virus cĩ dạng hình sợi cĩ thể dài một vài naromet (nm), vỏ bọc là Glycoprotein gồm protein gây ngưng kết hồng cầu (kháng nguyên bề mặt) - Haemagglutinin (viết tắt là H) và protein enzim cĩ thụ thể - Neuraminidae (viết tắt là N). Đây là kháng nguyên cĩ vai trị quan trọng trong miễn dịch bảo hộ và cĩ tính đa dạng cao. Hình thái vi cấu trúc của căn nguyên bệnh được Kawaoka (1988) và Murphy mơ tả khá chi tiết và nhấn mạnh rằng ARN của virus là một sợi đơn, âm và chia thành 8 đoạn kế tiếp nhau mang 10 mật mã cho 10 loại virion protein khác nhau là HA, NA, NP, NS1, NS2, M1, M2, PB1, PB2 và PA. Đoạn NS1 và NS2 dễ dàng tách được ở tế bào bị nhiễm. Tất cả 8 đoạn của sợi ARN cĩ thể tách và phân biệt rõ ràng thơng qua biện pháp điện di polyacrilamid gel. Các protein cĩ vỏ bọc nhân nối 8 đoạn này với nhau, được bọc bên ngồi bằng các protein và cĩ màng lipid ở ngồi cùng. Thành phần chính protein của virus chủ yếu là glycoprotein. Lipid tập trung ở màng virus và chủ yếu là lipid cĩ gốc phospho, số cịn lại là cholesterol, glucolipid và một số ít hydrocacbon gồm các loại men như galactose, mannose, ribose, fructose, glucosamin. Người ta lấy hai loại protein bề mặt là H (Haemagglutinin) và N (Neuraminidae) để phân loại virus cúm type A. Theo các tác giả Tơ Long Thành (2004) [24], Ilaria Capua và Stefano Marangon (2004) [31], Nguyễn Tiến Dũng và cộng sự (2005) [10], Hồng Thuỷ Long và Nguyễn Thị Hồng Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 22 Hạnh (2005) [17], Bùi Quý Huy (2004) [15], Phạm Sỹ Lăng (2005) [16] cĩ 15 loại protein H khác nhau về tính kháng nguyên được ký hiệu từ H1 đến H15 và cĩ 9 loại protein N cũng khác nhau về tính kháng nguyên được ký hiệu từ N1 đến N9. Theo Lê Văn Năm (2007) [21], Lisa F.P. Ng và cộng sự (2007) [44] cĩ 16 loại protein H và 9 loại protein N. Năm 2005, Fouchier và cộng sự [42] đã phân lập được protein H16 từ Hải Âu đen ở Hà Lan và Thuỵ Điển do đĩ cĩ tổng là 16 subtype HA (Nguyễn Tiến Dũng, 2006) [12]. Như vậy, từ 9 protein N và 16 protein H cĩ thể tạo ra 144 loại virus cúm type A khác nhau. Protein Haemagglutinin hay HA là một glucoprotein dưới dạng Trimer. Mỗi monomer gồm hai phần là HA1 và HA2. Hai phần của protein này được nối với nhau bằng một chuỗi các acid amine trong đĩ cĩ arginin. Tại vị trí này các men cắt protein cĩ sẵn trong cơ thể (trên các màng niêm mạc) của ký chủ sẽ cắt HA ra làm đơi, tạo điều kiện cho virus bám vào thụ thể của tế bào ký chủ. Do vậy đoạn này được gọi là cleavage site của HA. Do các enzym protease chỉ cắt protein tại các acid amine basic nên nếu vị trí này càng nhiều acid amine basic thì khả năng bị cắt đơi của HA lại càng cao dẫn đến khả năng để virus bám vào thụ thể tế bào và bắt đầu quá trình xâm nhập vào tế bào càng lớn. Dựa trên cơ sở này người ta đã phân loại virus cĩ độc lực cao là loại virus cĩ nhiều acid amine basic tại vị trí cleavage site và ngược lại. Protein NA chính là một loại enzym cĩ tên là Neuraminidae. Khi virus xâm nhập vào cơ thể, các mạch đường của protein HA và thụ thể của tế bào sẽ liên kết với nhau, gắn virus vào bề mặt tế bào. Sau đĩ nhờ NA cắt mối liên kết này đi làm cho virus cĩ thể vào bên trong, tiếp theo HA được cắt đơi hoặc nếu khơng như vậy thì virus sẽ bị rời ra khỏi tế bào. Thành phần hố học của virus gồm: ARN chiếm từ 0,8-1,1%, protein chiếm 70-75%, lipid 20-24% và 5-8% là hydrocacbon. Lipid tập trung ở màng virus và chủ yếu là lipid cĩ gốc phospho. Số cịn lại là cholesterol, glucolipid Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 23 và một ít hydrocacbon gồm các men như galactose, mannose, ribose, fructose và glucosamin. Thành phần chính protein của virus chủ yếu là glycoprotein. Acid nhân của virus gồm 8 đoạn gen cĩ cấu tạo là RNA chuỗi đơn âm. Chính vì bản chất các đoạn gen của virus cúm là RNA do đĩ khơng cĩ cơ chế tự sửa chữa khi sao chép sai lệch nên chúng rất rễ bị biến đổi. Đây là điểm đặc biệt nguy hiểm cho chăn nuơi gia cầm và đe dọa sức khoẻ con người. Theo Voyles (2002) 50 thì cĩ 8 đoạn ARN sợi đơn, cĩ chiều âm, đặc tính này cho phép sự tổ hợp di truyền trong một tế bào bị nhiễm hai hay nhiều virus và tạo ra nhiều loại virus mới khác với virus ban đầu. 1.3. Đặc tính sinh học của virus cúm gia cầm 1.3.1. Đặc tính về nuơi cấy và lưu giữ virus Virus cúm gia cầm phát triển tốt trong xoang niệu nang của phơi trứng gà ấp 9 - 11 ngày tuổi. Tiêm 0,1 - 0,3ml huyễn dịch bệnh phẩm như não, phổi, ruột, khí quản vào xoang niệu mơ của phơi gà 9 - 11 ngày tuổi, hàn kín lại rồi tiếp tục cho ấp ở 37oC trong 2 - 3 ngày. Một số ít chủng virus cĩ độc lực cao cĩ thể làm chết phơi trong vịng 18 - 24 giờ, nước trứng thu hoạch để ở 4oC qua một đêm, virus nhân lên trong nước trứng cĩ hiện tượng ngưng kết hồng cầu gà. Nếu khơng gây ngưng kết thì cần lấy nước trứng nĩi trên tiêm lần sau cho phơi trứng gà 9 - 11 ngày tuổi. Khả năng gây bệnh của virus rất cao nếu bảo quản nước phơi đĩ ở nhiệt độ âm 70oC (-70oC) hoặc khi cho đơng khơ. Virus cúm phát triển tốt trong tế bào xơ phơi gà CEF (Chicken Embryo Fibrolast) và tế bào dịng cĩ nguồn gốc thận chĩ MDCK (Madin - Darby - Canine - Kidney cells) với điều kiện mơi trường nuơi cấy khơng cĩ trypsin. 1.3.2. Sức đề kháng của virus Virus cúm gia cầm tương đối nhạy cảm với các chất hố học như formalin, ete, sodium desoxycholat, hydroxylamone. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 24 Virus khơng bền vững với nhiệt độ: Ở 50 - 60oC chỉ trong vài phút là virus mất hết độc tính, ở 70oC virus nhanh chĩng bị tiêu diệt. Ở nhiệt độ thấp, virus cĩ thể tồn tại trong phân ít nhất là 3 tháng. Trong nước, virus cĩ thể sống tới 4 ngày ở nhiệt độ 30oC và trên 30 ngày ở nhiệt độ 0oC. Đặc biệt là virus cĩ thể tồn tại khơng hạn định ở nơi nguyên liệu bị đơng lạnh. Trong điều kiện lạnh ở 4oC virus vẫn giữ được khả năng gây bệnh trong phân tới 30 – 35 ngày và 7 ngày ở nhiệt độ 20oC. Virus giữ tính gây bệnh lâu nhất trong vịng 48 giờ trên bề mặt các vật thể (Bean và cộng sự, 1982) [34]. Trong phủ tạng gia cầm, virus tồn tại 24-29 ngày, dưới ánh sáng mặt trời chiếu trực tiếp sống được 40 giờ, trong điều kiện chiếu ở mức bình thường sống được 15 ngày. Theo WHO (2004) [52] nghiên cứu gần đây nhất thấy rằng virus H5N1 phân lập từ vịt cĩ thể sống sĩt được 6 ngày ở 37oC. Do virus cúm gia cầm cĩ vỏ bọc ngồi là lipid nên chúng rất mẫn cảm với các chất tẩy rửa như formaldehyde, - propiolacton, ethanol. Sau khi tẩy vỏ bằng các chất như phenolic, NH4 + , natri hydrochlorit, acid lỗng và hydroxylamine cĩ thể phá huỷ virus cúm gia cầm. Người ta thường dùng các chất này như là các chất sát trùng hữu hiệu để tổng vệ sinh tẩy uế chuồng trại, dụng cụ và các thiết bị dùng trong chăn nuơi khi cơ sở chăn nuơi cĩ dịch hoặc cĩ nguy cơ bị đe doạ bởi các loại dịch bênh, đặc biệt là dịch cúm gia cầm. 1.3.3. Độc lực và phân loại virus cúm gia cầm Độc lực hay cịn gọi là khả năng gây bệnh của virus hay của một sinh vật. Tuy nhiên, cần chú ý phân biệt độc lực với khả năng gây nhiễm và tính dễ lây ở chỗ độc lực là khả năng gây ra vết thương, các triệu chứng và khả năng gây nguy hiểm đến tính mạng sống của ký chủ. Virus cúm H5N1 cĩ tính lây nhiễm cho người thấp nhưng khi ở người đã bị nhiễm thì phát bệnh rất nặng và cĩ tỷ lệ tử vong cao, tức là nĩ cĩ độc lực cao đối với con người. Độc lực của virus được xác định bằng hai phương pháp: Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 25 - Độc lực của virus cúm thường được xác định thơng qua trình tự các nucleotide của cleavage site. Do các enzym proteasa chỉ cắt protein tại các acid amine basic nên nếu vị trí này càng nhiều acid amine basic thì khả năng bị cắt đơi của HA càng lớn, dẫn đến khả năng để virus bám vào thụ thể tế bào và bắt đầu quá trình xâm nhập vào tế bào càng lớn. Dựa vào đĩ người ta phân loại virus cúm cĩ độc lực cao là loại virus cúm cĩ nhiều acid amine basic tại vị trí cleavage site và ngược lại là loại virus cĩ độc lực thấp là loại virus cĩ ít acid amin basic tại vị trí cleavage site. - Phương pháp thứ hai thực tế là các xét nghiệm trong phịng thí nghiệm nhưng được tiến hành trên động vật. Trong phương pháp này, để xác định độc lực của virus cúm trên gia cầm người ta dùng phương pháp xác định hệ số độc lực khi tiêm tĩnh mạch – IVPI (Intra Venous Pathogenicity Index). Tức là tiêm virus cúm vào tĩnh mạch cho gà 6 tuần tuổi. Quan sát triệu chứng lâm sàng số gà chết vào từng ngày và tính điểm theo phương pháp tính của Reed & M (cao nhất là 3 điểm). Sau 10 ngày nếu kết quả tính tốn cho thấy chỉ số này từ 1,2 trở lên thì virus được coi là cĩ độc lực cao – HPAI (Hight Pathogenic Avian Influenza). Ngược lại, nếu kết quả này là nhỏ hơn 1,2 thì virus được coi là cĩ độc lực thấp - LPAI (Low Pathogenic Avian Influenza). Ngồi ra, trên thực tế, trong nhiều trường hợp bệnh lý, một số virus cúm được coi là cĩ độc lực trung bình. * Nhĩm virus cĩ độc lực cao (HPAI): Tại Hội thảo Thế giới đầu tiên về bệnh cúm gà năm 1981, Bankowski và cộng sự đã thơng báo rằng virus cúm gà cĩ kháng nguyên bề mặt H7 thuộc loại virus cĩ độc lực cao. Nhưng ở Pensylvania (Mỹ) người ta đã chứng kiến trận dịch cúm gà đã gây chết 75% số đầu con, nhưng khi phân lập virus gây bệnh là H5N2 lại khơng cĩ kháng nguyên bề mặt H7. Điều này đã gây nhiều tranh cãi giữa các Nhà khoa học. Để giải quyết một cách khoa học, các Nhà khoa học đã thống nhất dựa vào Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 26 các chỉ số sau đây để khẳng định virus cúm gà cĩ độc lực cao - HPAIV (Hight Pathogenic Avian Influenza Virus): Sau 10 ngày tiêm tĩnh mạch 0,2ml nước trứng gà đã gây nhiễm virus được pha lỗng với tỷ lệ 1/10 cho gà mẫn cảm từ 4 – 66 tuần tuổi phải làm chết từ 75 – 100% số gà thực nghiệm. Đồng thời virus gây bệnh cúm (cĩ thể là type phụ) phải làm chết từ 20% số gà mẫn cảm thực nghiệm và phát triển tốt trên tế bào xơ phơi trong mơi trường nuơi cấy khơng cĩ trypsin (Lê Văn Năm, 2004) [19]. Virus độc lực cao gây bệnh nhanh, thời gian ủ bệnh ngắn, tỷ lệ gia cầm mắc bệnh chết cao, diễn biến phức tạp và cĩ su hướng lây lan nhanh ở tất cả các loại gia cầm từ 4 tuần tuổi trở lên trên vùng địa lý rộng lớn với biểu hiện tiêu chảy, hơ hấp, thần kinh và giảm đẻ rất nặng. * Nhĩm virus cĩ độc lực trung bình: Là những chủng virus cĩ thể gây ra dịch cúm cho gia cầm với các triệu chứng lâm sàng khá rõ rệt nhưng gây chết gia cầm khơng quá 15% tổng số gia cầm nhiễm bệnh. Tuy nhiên, trong thực tế loại virus này rất ít gặp. * Nhĩm virus cĩ độc lực thấp (LPAI): Là những virus phát triển tốt trong cơ thể gà nhưng khơng gây ra dịch cúm với các triệu chứng lâm sàng và khơng tạo ra bệnh tích đại thể, tốc độ lây lan chậm, tỷ lệ ốm và chết khơng đáng kể gọi là virus cúm thể độc lực thấp LPAIV (Low Pathogenic Avian Influenza Virus), (Lê Văn Năm, 2005) [20]. Tuy nhiên, đây chính là mối nguy hiểm rất lớn cho ngành chăn nuơi gia cầm và đe doạ tính mạng con người do chúng cĩ khả năng biến chủng để tạo thành một loại virus mới cĩ độc lực cao hơn và nguy hiểm hơn. 1.3.4. Sự thay đổi cấu trúc kháng nguyên của virus cúm gia cầm Đặc điểm của virus cúm gia cầm là rất dễ thay đổi cấu trúc kháng nguyên và khả năng biến chủng để thích nghi và tồn tại. Virus cúm cĩ tần số thay đổi kháng nguyên cao do đặc điểm phân đoạn trong các tổ hợp gen của Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 27 virus với việc xâm nhiễm bởi các virus khác nhau vào cùng một tế bào cơ thể sẽ cho phép sinh ra một loại virus cúm type A mới với độc lực mới và cĩ thể gây ra một dạng bệnh mới. Sự thay đổi này cĩ thể do đột biến ngẫu nhiên hoặc do sức ép miễn dịch và thường xảy ra theo hai cách: * Biến đổi đoạn kháng nguyên (thay đổi lớn) Hiện tượng hốn vị kháng nguyên hay di chuyển kháng nguyên (antigenic shift) là một sự thay đổi chủ yếu, bất ngờ, đột ngột trong các virus cúm type A, tạo ra haemagglutinin mới hoặc cả haemagglutinin và neuraminidae mới (Hồng Thuỷ Long và Nguyễn Thị Hồng Hạnh) (2005) [17]. Hiện tượng này xảy ra khi cĩ hai hay nhiều chủng virus, với nhiều đoạn ARN khác biệt nhau về mặt di truyền cùng lúc xâm nhiễm vào cùng một tế bào. Mỗi loại virus cùng sinh ra 8 đoạn gen cĩ thể lẫn lộn đoạn ARN của virus khác miễn là đủ 8 đoạn. Trên cơ sở đĩ hình thành một virus cúm mới thay thế các virus cũ trước đĩ đã nhiễm vào trong vật chủ (Bộ Nơng nghiệp và phát triển nơng thơn, 2007) [4]. Hiện tượng này gọi là shift. Ví dụ như khi thay đoạn mã hố cho haemagglutinin của người bằng đoạn của động vật, kết quả là tạo ra chủng virus mới với kháng nguyên H thay đổi, làm cho virus kháng lại kháng thể đã được hình thành trong đáp ứng miễn dịch lần trước. Vì vậy, do kiểu gen của virus cúm A gồm 8 đoạn nên về lý thuyết thì từ hai virus bố mẹ sẽ cĩ thể xuất hiện 28 = 258 kiểu kết hợp khác nhau của thế hệ sau. Trong thực tế sự kết hợp này đã phân lập được từ gia cầm 117 trường hợp. Biến chủng virus cĩ thể lây nhiễm vào vật chủ mới mà bố mẹ chúng khơng cĩ khả năng lây nhiễm. Khi hốn vị kháng nguyên xảy ra thì phần lớn con người, kể cả các lồi gia cầm khơng cĩ hoặc rất ít miễn dịch kháng lại virus mới này. Vì vậy nĩ được coi là nguyên nhân gây ra các vụ đại dịch ở người và gia cầm. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 28 Ký chủ mà tại đĩ hiện tượng shift xảy ra được gọi là bình trộn virus (mixing vessel). Trước đây, lợn được coi là bình trộn virus. Nghiên cứu đợt dịch cúm gia cầm tại Hồng Kơng năm 1997 đã cho phép xác định được cĩ 3 loại virus khác nhau là H5N1, H9N2 và H6N1 cùng nhiễm vào chim cút và đã tạo ra chủng virus H5N1. Nĩi cách khác là chim cút đã bình trộn virus và tạo ra chủng virus H5N1. Cĩ thể mơ tả theo sơ đồ sau: H5N1 (ngỗng) H6N1 H9N2 (chim cút) NP, MA, NS, PB1, PB2, PA Chim cút H5N1 mới Rất độc cho người H5N1 mới Rất độc cho gà * Biến đổi điểm kháng nguyên (thay đổi nhỏ) Một cách khác liên quan đến sự thay đổi kháng nguyên nhưng ở mức độ thấp được gọi là di nhập hoặc trơi dạt hay biến thể kháng nguyên (antigenic drift). Những thay đổi này xảy ra liên tục theo thời gian. Do đột biến ngẫu nhiên xảy ra ở gen mã hố cho haemagglutinin dẫn đến sự thay đổi acid amine trong protein haemagglutinin, mặc dù về cơ bản thì haemagglutinin vẫn là protein cũ. Chủng virus biến thể kháng nguyên trở thành chủng được chọn lọc trong quần thể do chúng cĩ khả năng xâm nhiễm vào ký chủ chưa miễn dịch và cĩ thể khơng được hệ miễn dịch của cơ thể nhận biết. Đặc biệt là chúng hồn tồn khơng bị tác động bởi hệ thống miễn dịch thu được của vật chủ, khơng bị trung hồ bởi các kháng thể được sinh ra do vật chủ được tiêm vaccin phịng bệnh (Bộ Nơng nghiệp và phát triển nơng thơn, 2007) [4]. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 29 Hiện tượng biến thể kháng nguyên tăng lên từ mùa này sang mùa khác nên đã gây rất nhiều khĩ khăn trong cơng tác phịng chống và thanh tốn dịch bệnh, đặc biệt là trong việc sản xuất vaccin phịng bệnh cho gia cầm. Theo Hồng Thuỷ Long và Nguyễn Thị Hồng Hạnh (2005) [17] thì hiện tượng hốn vị kháng nguyên xảy ra đơi lúc, cịn biến thể kháng nguyên gặp thường xuyên hơn. Cúm type A trải qua cả hai kiểu thay đổi nĩi trên, cịn cúm type B chỉ thay đổi bằng quá trình biến thể kháng nguyên dần dần. Cĩ thể mơ tả cơ chế dịch chuyển kháng nguyên theo sơ đồ sau: Virus cúm vịt H5N1 Virus cúm người H3N2 Tái tổ hợp trong lợn Tạo thành chủng virus cúm mới H5N2 nguy hiểm cho người và động vật Theo Trương Văn Dung và Nguyễn Viết Khơng (2004) [8] một trong những đặc điểm quan trọng của virus cúm là sự thay đổi kháng nguyên theo thời gian. Trình tự nucleotit của 8 đoạn gen là H5, N1, M, NP, NS, PA, PB1 và PB2 của 7 chủng phân lập đã được xác định và đặc tính di truyền của virus cúm H5N1 tại Việt Nam đã được phân tích cùng với trình tự nucleotit của hai virus phân lập từ hai bệnh nhân người Việt Nam gần đây. Kết quả cho thấy các chủng phân lập ở Việt Nam cụm lại thành một nhĩm, kể cả hai chủng phân lập từ người. Các cây tiến hố cho các gen là H5, M, NP, NS, PA, PB1 và PB2 cho thấy các chủng virus phân lập ở Việt Nam cùng nhĩm với các virus phân lập ở Hồng Kơng năm 2003, nghĩa là cĩ quan hệ gần. Tuy nhiên trình tự nucleotit của gen N1 cho thấy các chủng đã xác định làm thành hai dịng, chỉ một trong số đĩ giống với virus phân lập ở Hồng Kơng năm 2003. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 30 1.3.5. Quá trình xâm nhập và nhân lên của virus Khi cơ thể động vật hoặc con người hít phải hay ăn phải các chất cĩ chứa virus, ngay lập tức các virus đời bố mẹ sẽ bám và niêm mạc đường hơ hấp và đường tiêu hố nhờ chúng cĩ kháng nguyên H và N. Kháng nguyên H giúp cho virus bám vào lớp màng nhầy. Sau đĩ virus bám vào màng tế bào để rồi “chui” qua màng và đi vào trong tế bào chủ. Tại đây bộ gen của virus được “cởi vỏ” và thốt ra khỏi vỏ bọc rồi trở nên tự do để hoạt động. Khi virus cúm di chuyển được qua màng tế bào, ở đĩ chúng lợi dụng hệ thống tổng hợp protein của tế bào chủ để tổng hợp lên bộ gen của chúng. Sự sao chép của virus cúm đã được nhiều nhà khoa học nghiên cứu và mơ tả khá chi tiết. Kingsbury (1985), Fenner và cộng sự đã mơ tả tĩm tắt virus hấp thụ đối với các cảm thụ quan glycoprotein cĩ acid sialic trên bề mặt tế bào, sau đĩ virus xâm nhâp vào tế bào qua receptor mediate endocytoci, nĩ bao gồm các exposure với nồng độ pH thấp trong endosom, dẫn đến sự thay đổi trong HA là sự kết hợp màng trung gian. Vì vậy nucleocapxit đi vào bên trong nguyên sinh chất và di chuyển vào trong nhân. Virus cúm dùng cơ chế đơn nhất để sao chép trong đĩ một loại men nội nhân (viral endonuclease) tách từ đầu 5’ của mARNs tế bào và dùng nĩ như một cái mồi để sao chép nhờ sự vận chuyển virus sau monocistronic mARNs được tạo ra và dịch chuyển thành HA, NA, NP và ba men polymerases là PB1, PB2 và PA. Các mARN đối với các gen NS và M được nối với sản lượng hai mARNs, được dịch chuyển trong các khung đọc khác nhau và tạo ra các protein NS1, NS2, M1, M2, HA và NA được đường hố trong mạng lưới võng mạc nội mơ và được điều chỉnh trong tiểu thể golgi, rồi được chuyển tới bề mặt tế bào và bắt đầu hình thành virion. Một yếu tố quan trọng đối với HA là được phân ra nhờ men protease của tế bào chủ thành HA1 và HA2, mà chúng vẫn gắn kết được nhờ mối liên Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 31 kết disulfis, việc cắt ra là yêu cầu đối với việc sản xuất các virus sau khi bị nhiễm các virus và ghép các protein virus và ARN, virus tồn tại trong tế bào là nhờ sự nảy chồi từ màng plasma. Mặc dù chưa rõ virus diệt tế bào như thế nào nhưng những nghiên cứu gần đây cho thấy mơ tế bào nuơi cấy bị nhiễm virus trải qua apotosis (quá trình chết theo sinh lý bình thường của tế bào cơ thể) đã bị đảo lộn, bị phá vỡ lập trình, apotosis trong cúm cũng được xác định. Theo Lê Văn Năm (2004) [18] sau khi vào nguyên sinh chất và nhân tế bào, virus trưởng thành nhanh và phát triển theo phương thức tự nhân đơi. Tuy nhiên, theo Bùi Quang Anh và Văn Đăng Kỳ (2004) [1] thì virus cúm được nhân lên trong đường hơ hấp và đường tiêu hố. Như vậy, quá trình nhân lên của virus kết thúc với kết quả từ một hạt virus (bố mẹ) sẽ cĩ hàng ngàn virus mới được tạo ra. Tuy nhiên, người ta đã tính được rằng, trong quá trình lắp ráp virus khơng cần nhiều năng lượng mà chỉ khoảng 30%, nghĩa là chỉ 30% số virus đời con là những hạt virion khơng hồn chỉnh cĩ khả năng gây nhiễm, cịn lại là các virus ở dạng khiếm khuyết. 1.4. Dịch tễ của bệnh Bệnh cúm gia cầm xảy ra với tất cả các dịng, giống gia cầm như gà, vịt, ngan, ngỗng, gà tây, đà điểu, chim cút, chim cảnh cũng như các lồi chim hoang dã, nhưng ở gà cơng nghiệp và gia cầm nuơi tập trung thường cĩ biểu hiện bệnh nặng hơn. Gia cầm ở mọi lứa tuổi đều cĩ nguy cơ mắc bệnh cúm nhưng chủ yếu ở gia cầm từ 4 – 66 tuần tuổi. Ở nước ta, Lê Văn Năm (2004) [19] đã phát hiện bệnh cúm gia cầm xảy ra sớm nhất ở gà là 26 ngày tuổi, vịt là 28 ngày tuổi, ngan Pháp là 24 ngày tuổi, tuổi mắc bệnh muộn nhất ở gà là 10 tháng, vịt là 18 tháng và ngan là 14 tháng. Gia cầm dễ bị bệnh và cĩ tỷ lệ chết cao nhất ở những nơi bệnh phát ra lần đầu và ở tuổi sắp đẻ hoặc đang trong thời kỳ đẻ cao nhất. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 32 Bệnh xảy ra quanh năm, khơng phụ thuộc vào mùa vụ nhưng chủ yếu và dễ phát hơn vào lúc giao thời từ mùa thu sang mùa đơng hoặc cĩ các yếu tố stress gây hại làm giảm sức đề kháng của gia cầm, thường vào các tháng 11, 12, 1, 2 và 3 hàng năm, đặc biệt vào cuối tháng 1 đầu tháng 2, tỷ lệ mắc bệnh cao nhất ở đàn cĩ từ 100 – 5000 con (25,6% đợt 2 và 33,21% đợt 3) và giảm dần ở những trại chăn nuơi cĩ số lượng lớn hơn (Phạm Sỹ Lăng, 2005) [16], cũng như sự thay đổi đột ngột về thức ăn, nước uống, thời tiết. Bệnh lây lan do truyền ngang, chủ yếu do tiếp xúc trực tiếp giữa gia cầm khoẻ mạnh với gia cầm mắc bệnh, qua thức ăn, nước uống, các dụng cụ chăn nuơi, các phương tiện vận chuyển, qua phân rác cĩ chứa virus cúm. Ở trứng nhiễm virus bị vỡ trong tủ ấp sẽ gây nhiễm cho gà mới nở (OIE, 2002) [45]. Đặc biệt người ta đã tính được rằng trong 1 gam phân gà mắc bệnh cúm cĩ đủ lượng virus để gây bệnh cho 1 triệu gà khác (APHIS, 2002) [33]. Chỉ 1 – 2 ngày sau khi xâm nhiễm vào cơ thể, virus cúm gia cầm được đào thải ra ngồi mơi trường qua phân, nước mũi và miệng. Virus tồn tại khá lâu trong vật chất hữu cơ như trong phân 30 – 35 ngày ở 4oC và 7 ngày ở 20 oC. Trong các nguồn thức ăn, nước uống bị ơ nhiễm, virus cĩ khả năng tồn tại hàng tuần mà vẫn cĩ độc lực và khả năng gây bệnh cho gia cầm. Trong điều kiện bảo quản đơng lạnh, virus tồn tại khơng hạn định. Đây là những nguồn bệnh chính, nguy hiểm và tiềm tàng để khơng chỉ gia cầm mà các động vật cĩ vú khác cũng rất rễ bị phơi nhiễm, đặc biệt là con người. Ở gia cầm bị phơi nhiễm, thời kỳ ủ bệnh trung bình từ vài giờ đến 3 ngày, phổ biến nhất là từ 1 - 3 ngày, đơi khi cĩ trường hợp kéo dài từ 14 – 20 ngày. Tỷ lệ chết dao động từ 15 – 100% số gia cầm mắc bệnh. 1.4.1. Ký chủ của virus Ký chủ là từ dùng để chỉ những sinh vật mà trên hoặc bên trong nĩ cĩ sinh vật khác sinh sống (ký sinh) gây ảnh hưởng tới cuộc sống của bản thân. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 33 Virus cúm gia cầm (ký sinh tuyệt đơi) cĩ khả năng xâm nhập, gây nhiễm và gây bệnh cho tất cả các lồi gia súc và gia cầm, thậm trí cả động vật dưới nước như cá voi và hải cẩu. Tuy nhiên, về sinh thái bệnh, bệnh cúm gia cầm cĩ sinh thái bệnh vơ cùng phức tạp. Mỗi loại ký chủ khác nhau lại cĩ vai trị khác nhau trong việc lưu giữ, phát tán và lây lan dịch bệnh. Do vậy, để chủ động trong việc phịng chống dịch cúm, người ta đã chia ký chủ của virus cúm ra làm ba loại: * Ký chủ lưu giữ hay mang mầm bệnh Đây là loại ký chủ thường nhiễm nhưng khơng phát thành bệnh hoặc chỉ phát bệnh rất nhẹ hoặc chỉ những con non mới mắc bệnh cịn các con vật trưởng thành khi nhiễm virus thì chỉ tạo ra miễn dịch. Trong trường hợp bệnh cúm, các lồi chim hoang dã và thuỷ cầm được coi là ký chủ lưu giữ hay mang mầm bệnh. Tuy nhiên cịn phụ thuộc vào độc lực của virus vì đối với virus cúm H5N1 trong thực tế đã gây bệnh với tỷ lệ chết rất cao ở thuỷ cầm. Virus cúm đã phân lập được ở hầu hết các lồi chim hoang dã như vịt trời, thiên nga, hải âu, mịng biển, vẹt các loại, chim thuộc họ sẻ, diều hâu. Tần xuất và số lượng virus phân lập được ở lồi thuỷ cầm đều cao hơn ở các lồi khác. Vịt từ khi bị nhiễm đến khi bắt đầu thải virus trong vịng 30 ngày (Bùi Quang Anh và Văn Đăng Kỳ, 2004) [1]. Thuỷ cầm, đặc biệt là vịt, chim bờ biển, hải âu được coi là ký chủ mang mầm bệnh tự nhiên của virus cúm gia cầm (Wedster và cộng sự, 1992) [51]. Tất cả các lồi virus cúm type A được biết cho đến nay đều phát hiện thấy ở lồi lơng vũ và thuỷ cầm hoang dại được coi là ký chủ mang trùng quan trọng nhất của virus cúm (Fouchier và cộng sự, 2004) [41]. Do đặc điểm cấu tạo gen của virus cúm gia cầm trong các lồi dã cầm khiến cho các lồi này khi mang virus là nguồn reo rắc virus cho các lồi khác, đặc biệt là gia cầm. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 34 * Ký chủ hứng chịu (Bị tràn ngập, bị đổ lên đầu-Spillover host) Đây là loại ký chủ mẫn cảm với virus cúm và thải virus ra mơi trường xung quanh làm lây nhiễm cho các cá thể khác. Loại ký chủ này thường phát bệnh rất nặng khi bị nhiễm nhưng lại khơng thể lưu giữ lâu dài mầm bệnh trong cùng một lồi vì khi bị nhiễm virus thì chúng sẽ bị tiêu diệt. Nĩi cách khác là nếu lồi động vật này khơng tiếp xúc với ký chủ lưu giữ thì mầm bệnh (virus) tự nhiên sẽ tự tiêu vong trong lồi ký chủ lưu giữ. Các lồi gia cầm cạn như gà, gà tây, gà lơi, trĩ, đà điểu… thường được coi là ký chủ hứng chịu của virus cúm và bệnh thường phát ra rất nặng ở lồi này, đồng thời lượng virus sinh ra cũng rất lớn. Virus gây bệnh cho phổ ký chủ rộng hơn. Thơng thường ở vịt (ký chủ lưu giữ), virus cúm chỉ gây bệnh ở một phạm trù nào đĩ (vịt non chẳng hạn) và tập trung vào đường ruột, thì ở lồi ký chủ hứng chịu (gia cầm cạn) virus gây bệnh ở mọi lứa tuổi và nhân lên ở mọi cơ quan nội tạng của gia cầm cạn. Tuy vậy, ở gia cầm như đã nĩi ở trên cịn cĩ các loại virus gọi là độc lực thấp (LPAI) khơng gây bệnh lâm sàng. Nhưng các loại virus này khi nhiễm chuyển tiếp qua nhiều đời ở gia cầm sẽ trở thành loại virus cĩ độc lực cao (HPAI). Trong khi đĩ ở ký chủ lưu giữ mầm bệnh, virus hầu như ổn định về mặt di truyền. Vì vậy, người ta đưa ra thuyết về sự ngưng trệ tiến hố (Evolutionary stosis) của virus cúm ở lồi thuỷ cầm, nhưng trên ký chủ hứng chịu chúng tiến hố (đột biến) rất mạnh. Đây là lý do giải thích tại sao các nhà khoa học cho rằng cần phải diệt hết gia cầm mắc bệnh cúm bất kể là bị nhiễm subtype nào vì sợ rằng chúng sẽ sinh ra những chủng virus mới, trong khi sự lưu hành virus cúm trong đàn vịt khơng đáng lo ngại như trong đàn gà. * Ký chủ lệch Là lồi động vật hiếm khi bị nhiễm virus nhưng khi bị nhiễm sẽ phát bệnh rất nặng và khơng hoặc bài thải rất ít virus để lây nhiễm cho các cá thể Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 35 xung quanh. Hiện nay con người và một số động vật cĩ vú khác được coi là ký chủ lệch của virus cúm H5N1. Sự phân chia này khơng mang tính tuyệt đối vì một khi virus cúm H5N1 cĩ khả năng lây từ người sang người thì con người lại trở thành ký chủ hứng chịu. Mặt khác, với cúm H3N2 hiện đang lưu hành gây ra bệnh cúm thơng thường ở người thì con người lại trở thành ký chủ lưu trữ H3N2 hoặc năm giữa ký chủ lưu trữ và ký chủ hứng chịu. Tuy vậy, sự phân chia này chỉ cĩ tác dụng phân biệt, diễn tả và quản lý bệnh theo từng giai đoạn tiến triển của dịch. Nhưng với dịch cúm do H5N1 gây ra hiện nay, vịt khơng phải là ký chủ lưu trữ vì khi bị nhiễm chúng cũng phát bệnh và cĩ tỷ lệ chết rất cao. Đây là điều đặc biệt mới đối với bệnh cúm gia cầm. 1.4.2. Sự lưu hành virus cúm trên đàn gia cầm Trong cơng tác chẩn đốn và phịng chồng dịch cúm gia cầm, việc giám sát sự lưu hành virus là một nhiệm vụ quan trọng bắt buộc với mục tiêu phát hiện sớm và kịp thời những đàn gia cầm mang trùng để cĩ những biện pháp hiệu quả nhằm tiêu diệt mầm bệnh. Trên Thế giới, đã nhiều Quốc gia xuất hiện dịch cúm gia cầm, cĩ nước áp dụng chiến lược tiêm phịng vaccin, cĩ nước tiến hành tiêu huỷ tồn bộ gia cầm theo bán kính rộng khi cĩ gia cầm mắc bệnh hoặc cĩ sự lưu hành virus nhưng việc giám sát sự lưu hành virus thường được thực hiện một cách rất thường xuyên. Tại Việt Nam, ngay từ lần đầu tiên xuất hiện dịch (2003 – 2004), virus gây bệnh được xác định thuộc type A H5N1 nhưng trước đĩ chúng ta khơng cĩ số liệu về loại virus và sự lưu hành trong đàn gia cầm ở Việt Nam (Nguyễn Tiến Dũng, 2005) [11]. Sau khi đợt dịch này kết thúc, tháng 3 và 4/2004, Nguyễn Tiến Dũng và cộng sự (2005) [10] đã tiến hành lấy 1.002 mẫu huyết thanh và ổ nhớp của 130 hộ chăn nuơi gia cầm thuộc 13 xã của tỉnh Thái Bình để nghiên cứu về sự lưu hành virus cúm. Kết quả cho thấy xét nghiệm huyết Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 36 thanh tìm kháng thể kháng virus cúm gia cầm H5 bằng phương pháp HI đã cĩ 60,8% ở vịt, 23,6% ở ngan và 4,8% ở gà dương tính với huyết thanh và ơng khẳng định rằng mặc dù dịch lâm sàng đã hết nhưng tỷ lệ nhiễm virus H5N1 cịn rất cao sau đợt dịch đầu năm 2004, điều này nĩi lên virus vẫn tiếp tục tồn tại và lưu hành trong đàn gia cầm. Cũng theo ơng khi nghiên cứu ở miền Bắc nước ta thấy tỷ lệ nhiễm virus ở các hộ nuơi vịt hoặc vịt lẫn với gà cĩ nguy cơ nhiễm virus 69,5% cao gấp 8 lần so với ở các hộ chỉ chăn nuơi gà với 8,4%. Vịt thường tạo ra kháng thể kháng virus cúm sau khi bị nhiễm từ 5 – 6 ngày. Như vậy, tỷ lệ vịt cĩ kháng thể là gián tiếp thể hiện tỷ lệ nhiễm virus trong đàn vịt. Tỷ lệ này thường tăng dần bắt đầu vào tháng 11 và đạt đỉnh cao vào tháng 3 hàng năm. Như vậy mùa đơng là mùa vịt bị mắc virus cúm (Nguyễn Tiến Dũng, 2006) [12]. Cũng theo ơng, nhiều chủng virus cúm H5N1 gây bệnh và gây chết cho vịt nên số liệu về huyết thanh cĩ thể khơng phản ánh đúng thực tế nhiễm virus. Năm 2005, Trương Văn Dung và cộng sự [9] đã lấy 60 mẫu huyết thanh và 60 mẫu ổ nhớp để kiểm tra sự lưu hành virus cúm trước khi tiêm thử nghiệm vaccin phịng cúm gia cầm ở 3 đàn vịt tại Bắc Ninh. Kết quả cho thấy, tất cả các mẫu ổ nhớp đều cho kết quả âm tính cịn mẫu huyết thanh cĩ 19/60 mẫu dương tính với kháng thể bằng 31,7% thuộc 1 trong 3 đàn bằng 33,3%. Kiểm tra 100 mẫu huyết thanh và 100 mẫu ổ nhớp của 2 đàn gà tại Hà Tây trước tiêm thử nghiệm và đều cho kết quả âm tính. Năm 2007, theo báo cáo của Bộ Nơng nghiệp và phát triển nơng thơn [3] đã kiểm tra 8.278 mẫu được lấy tại 78 cơ sở, điểm giết mổ và chợ buơn bán gia cầm sống trên cả nước, kết quả cho thấy tỷ lệ lưu hành virus là 7,96%. Cũng theo Bộ Nơng nghiệp thì virus vẫn lưu hành trên đàn gia cầm và dịch sẽ bùng phát bất cứ lúc nào khi cĩ đủ điều kiện. Cĩ thể thấy rằng vịt cĩ tỷ lệ mang trùng cao hơn rất nhiều so với đàn ngan, đặc biệt là so với gà. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 37 1.5. Triệu chứng lâm sàng Mặc dù bệnh cúm gia cầm thể độc lực cao (HPAI) là thể cực kỳ nguy hiểm nhưng các biểu hiện lâm sàng và diễn biến của bệnh thường khơng đồng nhất mà rất đa dạng và phức tạp. Khơng cĩ triệu chứng lâm sàng đặc trưng cho bệnh cúm gia cầm thể độc lực cao nhưng phải chú ý ngay lập tức đến nĩ khi thấy tỷ lệ chết cao (Cục Thú y, VSF-CICDA, 2007) [7]. Bệnh cúm gia cầm khi xảy ra phụ thuộc vào rất nhiều yếu tố như độc lực của virus, tuổi gia cầm mắc bệnh, phương thức chăn nuơi và các yếu tố mơi trường khác thúc đẩy, số lượng virus hay giới tính của gia cầm. Các gia cầm non thường cĩ biểu hiện bệnh nặng hơn. Các lồi thuỷ cầm, đà điểu và các lồi chim hoang dã cĩ thể cĩ độ mẫn cảm thấp hơn nhưng lại cĩ thể trở thành vật mang trùng rất nguy hiểm cho các lồi động vật mẫn cảm khác. Sau khi xâm nhiễm vào cơ thể, virus cúm vào máu và nhân lên rất nhanh về số lượng. Một số trường hợp dịch cúm nổ ra nhưng vẫn khơng cĩ dấu hiệu lâm sàng, xong đa số những trường hợp như vậy thường gây nên hiện tượng nhiễm trùng huyết, viêm não tuỷ, viêm đường hơ hấp cấp, viêm đường tiêu hố cấp và xuất huyết tràn lan ở các phủ tạng. Gia cầm bệnh thể hiện tăng nhiệt độ đột ngột, cĩ thể lên đến 44 – 45oC. Các triệu chứng hơ hấp thường xuất hiện đầu tiên và khá điển hình như khẹc, lắc đầu, vẩy mỏ, chảy nước mắt, nước mũi, chảy dãi và khĩ thở. Mí mắt bị viêm và sưng mọng, đầu sưng và mặt bị phù nề. Mào và tích dày lên do thuỷ thũng, cĩ nhiều điểm và đám xuất huyết. Nhiều trường hợp thấy hoại tử ở mào và tích (Beard, 1998) [35]. Xuất huyết dưới da vùng ngực và chân là biểu hiện lâm sàng rất đặc trưng của bệnh, xác gà bệnh thâm xám. Gia cầm bệnh cĩ biểu hiện thần kinh rất đặc trưng như đi lại loạng choạng, mất thăng bằng, đi siêu vẹo, run rẩy và mệt mỏi, nằm lì tụm đống với nhau. Gia cầm tiêu chảy mạnh, phân lỗng mầu trắng hoặc trắng xanh. Kết Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 38 mạc mắt sưng thuỷ thũng và xuất huyết (CDC) [37]. Bệnh lây lan rất nhanh, gia cầm ủ rũ, xơ xác, giảm năng xuất trứng rõ rệt. Ở vịt và ngỗng cịn cĩ hiện tượng mắt màu khĩi đục (Capua và Mutinelli, 2001) [36], (Aceillo, 1998) [32]. Tỷ lệ chết ở đàn nhiễm bệnh cĩ thể lên đến 100%. 1.6. Giải phẫu bệnh lý 1.6.1. Bệnh lý đại thể: Phụ thuộc rất nhiều vào số lượng, độc lực của virus và quá trình diễn biến của bệnh mà cĩ thể chia ra các trường hợp sau: * Trường hợp bệnh nhẹ: Chỉ thấy viêm mũi từ thể cata, serofibrin đến nhầy mủ và bị casein hố gây tịt mũi, thối mi mắt. Khi mổ khám thấy khí quản phù nề, đọng nhiều dịch rỉ viêm, viêm sero đến casein, nhiều đờm. Túi khí bị dày lên và cĩ nhiều fibrin bám dính. Phúc mạc bị viêm nặng từ cata đến fibrin do trứng non bị dập vỡ nên cĩ thể gọi là “viêm phúc mạc lịng đỏ trứng” (Egg yolk peritonitis). Buồng trứng viêm xuất huyết, trứng non dập vỡ, ống dẫn trứng bị viêm dịch rỉ đến casein. Ruột bị viêm xuất huyết từ cata đến fibrin, nặng nhất là vùng ruột non, ruột thừa và hậu mơn. * Trường hợp bệnh nặng: Nhiều trường hợp trong ổ dịch cúm, gia cầm chết quá nhanh khơng để lại bệnh tích điển hình, nhưng đại bộ phận những gia cầm khác thì các biến đổi đại thể lại thể hiện khá rõ như mũi bị viêm tịt, mào tích thâm tím, sưng dày lên, xuất huyết điểm và hoại tử. Cắt đơi mào hoặc tích thấy cĩ mầu vàng xám, ĩng ánh như gelatin. Mí mắt và mặt bị phù nề, đầu sưng to. Xuất huyết dưới da ở chân và một số vùng khác như lưng và đùi. Xác gà vẫn béo nhưng thâm và khơ. Viêm teo, xuất huyết và gây hoại tử ở gan, lách, thận. Tuỵ sưng to cĩ vạch vàng và đỏ xen kẽ. Gia cầm chết thường ở tư thế cổ và chân duỗi dài, trong miệng cĩ nhiều dãi nhầy và đặc. Viêm xuất huyết tồn bộ phủ tạng như mề, dạ dày tuyến, ruột non, ruột già, manh tràng, hậu mơn, túi fabricius. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 39 Ở gà, dạ dày tuyến, van hồi manh tràng và niêm mạc hậu mơn viêm xuất huyết từ cata đến fibrin rất nặng. Tim bơi trong bao dịch thẩm xuất mầu vàng và xuất huyết điểm. Viêm dính phúc mạc và túi khí. Xuất huyết dưới da và cơ vùng đùi, xuất huyết bên trong lồng ngực, xuất huyết mỡ bụng, mỡ bao tim, mỡ màng treo ruột. Niêm mạc khí quản xuất huyết, chứa nhiều đờm dãi. Ở ngan, vịt một trong hai lá phổi luơn bị viêm xuất huyết nặng và bị gan hố, khi bỏ vào nước thì phổi bị chìm (khoảng trên 2/3 phổi bị chìm dưới mặt nước), tim bơi trong bao dịch thẩm xuất mầu vàng và bị xuất huyết điểm. Xuất huyết bên trong lồng ngực. Đường ruột ngan vịt chứa rất ít thức ăn. 1.6.2. Bệnh lý vi thể: Các biến đổi đặc trưng về tổ chức học bao gồm phù nề, xung huyết, xuất huyết và thâm nhập lympho đơn nhân ở cơ vân, cơ tim, lách, phổi, mào, tích, gan, thận, mắt và thần kinh. Ngồi tế bào lympho đơn nhân hình thái ra cịn cĩ tế bào đặc trưng cho phản ứng viêm hoại tử. 1.7. Chẩn đốn bệnh Trong chẩn đốn cúm gia cầm, người ta thường dùng phương pháp sau: 1.7.1. Chẩn đốn dịch tễ học: Gia cầm ở mọi lứa tuổi đều mắc nhưng thường gặp là từ 4 – 66 tuần tuổi. Bệnh nặng nhất thường ở gia cầm đang đẻ và lúc đẻ cao nhất hoặc nơi lần đầu xảy ra dịch. Bệnh xảy ra quanh năm nhưng thường vào thời điểm giao thời, chủ yếu vào các tháng 11, 12, 1, 2 và 3 hàng năm. Bệnh xảy ra dồn dập và nhanh chĩng trở thành dịch chủ yếu trong vài giờ đến vài ngày. 1.7.2. Chẩn đốn lâm sàng Căn cứ vào các triệu chứng lâm sàng như thở khĩ và thở dốc. Viêm tịt mũi, phù nề đầu và mặt. Phù thũng, xuất huyết và hoại tử ở mào và tích. Xuất huyết dưới da chân là một trong những biểu hiện lâm sang rất đặc trưng của Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 40 bệnh cúm gia cầm. Gia cầm bệnh cĩ biểu hiện thần kinh, tiêu chảy nặng, chảy nước mắt, nước mũi. Khi chết, gia cầm thường nằm ở tư thế duỗi cổ và chân. 1.7.3. Chẩn đốn thơng qua giải phẫu bệnh lý Bệnh tích tập trung rất điển hình ở vùng đầu và mặt như phù đầu và mặt, mào tích thâm tím, sưng phù nề và xuất huyết. Mổ khám thấy các cơ quan nội tạng bị viêm, xuất huyết và hoại tử ở tim, gan, lách, phổi, thận, tuỵ sưng cĩ vạch đỏ và vàng xen kẽ. Viêm dính phúc mạc và buồng trứng, viêm ống dẫn trứng, trứng non bị dập vỡ. Xuất huyết mỡ bụng, mỡ tim, mỡ màng treo ruột, xuất huyết niêm mạc tiêu hố và hậu mơn. Thịt thâm xám, xuất huyết lồng ngực, cơ ngực và cơ đùi. Đặc biệt điển hình là xuất huyết da chân. 1.7.4. Chẩn đốn virus học Trong chẩn đốn bệnh cúm gia cầm, việc phân lập và xác định virus là điều bắt buộc và cực kỳ quan trọng. Bệnh phẩm đầu tiên được lấy là dịch thẩm xuất khí quản hoặc hậu mơn của gà bệnh được nuơi cấy trong mơi trường cĩ hàm lượng kháng sinh cao. Phương pháp đơn giản nhất là phân lập virus qua phơi gà, cụ thể như sau: Lấy 0,2-0,3ml nước bệnh phẩm tiêm vào túi khí của phơi gà 10-11 ngày tuổi, hàn lại và tiếp tục cho ấp. Các phơi bị tạp khuẩn sẽ chết sau 24 giờ và phải được bỏ đi. Số ít phơi sống cịn lại sau 24 giờ được tiếp tục theo dõi đến 72 giờ. Cĩ thể lấy nước phơi từ những phơi chết trong khoảng 48 giờ và sau 48 giờ hoặc từ phơi chưa chết đến khoảng 72 giờ vào việc xác định virus. Đây là thời gian mà số lượng virus cúm (nếu cĩ) đã đạt đến mức cao cần thiết. Để xác định virus phân lập được cĩ phải là virus cúm gia cầm hay khơng ta dùng phương pháp ngưng kết hồng cầu (HA). Nếu phản ứng HA khơng cho kết quả dương tính thì tiếp tục lấy nước phơi đĩ tiêm truyền lần hai vào phơi gà 10 – 11 ngày tuổi và sau đĩ lại dùng phản ứng HA để kiểm định lại. Nếu kết quả vẫn là âm tính thì tiến hành nuơi cấy trên tế bào một lớp xơ Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 41 phơi gà hoặc tế bào thận chĩ trong điều kiện mơi trường nuơi cấy khơng cĩ trypsin sẽ cho kết quả tin cậy (OIE, 2005) [46]. Phương pháp phổ biến nhất và cho kết quả nhanh nhất thường dùng hiện nay là sử dụng phản ứng RT - PCR (Reverse Transcription PCR): Lấy mẫu bệnh phẩm như phân, gan, lách, thận, dịch thẩm xuất, dịch ngốy họng của gia cầm rồi sử dụng phản ứng RT - PCR để phân lập và giám định virus trong các phịng thí nghiệm đủ tiêu chuẩn. Ngồi ra cĩ thể sử dụng phương pháp chẩn đốn huyết thanh miễn dịch: Phương pháp ngưng kết hồng cầu (HI) hay phản ứng miễn dịch gắn men ELISA phát hiện kháng thể kháng virus cúm trong máu của gia cầm. Phản ứng này cho kết quả chính xác (95 – 96%), nhanh và sớm bệnh cúm gia cầm. 1.7.5. Chẩn đốn phân biệt: Chú ý phân biệt với bệnh Newcastle, Chlamidia, một số bệnh do Paramyxovirus, bệnh Gumboro, IB, viêm thanh khí quản truyền nhiễm, viêm xoang do vi khuẩn và dịch tả ở vịt, nhiễm E.coli cấp và bệnh tụ huyết trùng. 1.8. Điều trị bệnh Lần đầu tiên trên Thế giới, năm 1970 Lang.G.O và cộng sự đã dùng Adamantadin để điều trị cúm ở gà tây cho kết quả khá tốt. Sau đĩ, năm 1984 Beard.C.W và Webster cùng cộng sự năm 1985 đã tiếp tục dùng Adamantadin kết hợp với Rimantadin cho vào nước uồng đã làm giảm tỷ lệ chết xuống cịn 50% so với lơ đối chứng trong dịch cúm. Nhưng ngày nay phương pháp này đã khơng được sử dụng do thuốc tích tụ trong thịt và lịng đỏ trứng gây ảnh hưởng đến sức khoẻ cho con người. Hiện nay, theo tổ chức Dịch tễ Thế giới (OIE) khi một sơ sở cĩ dịch cúm gia cầm thì tồn bộ gia cầm của cơ sở đĩ phải huỷ bỏ và thực hiện việc tiêu độc khử trùng, tuyệt đối khơng điều trị bởi hai lý do sau: Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 42 + Tất cả kháng sinh và hố dược hiện nay đang được sử dụng đều khơng diệt được virus cúm trong cơ thể gia cầm. + Virus lây lan rất nhanh và mạnh lại rất nguy hiểm, cĩ thể lây nhiễm và gây bệnh cho tất cả các loại gia cầm, các lồi chim hoang dã và một số động vật cĩ vú khác, đặc biệt là con người. 1.9. Phịng bệnh Để đạt được hiệu quả cao trong cơng tác phịng chống dịch bệnh cúm gia cầm thì cần phải thực hiện đồng bộ các biện pháp cụ thể sau: - Khi phát hiện gia cầm ốm nghi mắc bệnh cúm gia cầm, chủ nuơi hoặc người chăn nuơi phải báo ngay cho chính quyền địa phương và cơ quan chuyên mơn thú y nơi gần nhất để nhanh chĩng chẩn đốn xác minh và xử lý kịp thời khi phát hiện dịch bệnh. - Bao vây cách ly và khoanh vùng ổ dịch, tiêu huỷ tồn bộ gia cầm trong ổ dịch bằng các biện pháp như chơn, đốt là những biện pháp khống chế dịch tốt nhất (Stegeman và cộng sự, 2004) [47]. - Thực hiện việc vệ sinh khử trùng tiêu độc tồn bộ ổ dịch bằng các loại thuốc sát trùng cĩ hiệu quả cao. Đặc biệt là chuồng trại, khu vực chăn nuơi, dụng cụ chăn nuơi, mơi trường chăn nuơi, thức ăn, nước uống, phương tiện vận chuyển, kể cả đối với con người. - Kiểm dịch nghiêm ngặt đối với việc vận chuyển, lưu thơng, buơn bán và giết mổ gia cầm. Nghiêm cấm việc vận chuyển gia cầm ra, vào ổ dịch. - Tuyên truyền sâu rộng đến người dân và các hộ chăn nuơi về bệnh cúm gia cầm và các biện pháp phịng chống khi cĩ dịch xảy ra. - Thực hiện việc tiêm phịng bắt buộc đối với tất cả các loại gia cầm định kỳ theo quy định (FAO/OIE/WHO, 2005) [40]. Cĩ 3 chiến lược tiêm Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 43 phịng cĩ thể áp dụng là: Tiêm phịng bao vây, tiêm phịng khi cĩ dấu hiệu của virus và tiêm phịng cơ sở (FAO, 2004) [38]. - Quy hoạch hiệu quả việc chăn nuơi gia cầm theo quy mơ tập trung, nuơi nhốt và vùng an tồn dịch bệnh, thực hiện việc giết mổ gia cầm tập trung trong các lị giết mổ đủ tiêu chuẩn cĩ sự giám sát chặt chẽ của cơ quan chuyên mơn Thú y kể cả trong vận chuyển trước và sau giết mổ. - Thực hiện chế độ chăn nuơi an tồn tất cả cùng vào - tất cả cùng ra (all– in/all – out). Ngăn chặn sự tiếp xúc giữa chim hoang dã với gia cầm và các loại thức ăn, nước uống và mơi trường chăn nuơi (FAO/OIE/WHO, 2005) [39]. Hạn chế sự tiếp xúc giữa gia cầm với con người (APHIS, 2002) [33]; (FAO, 2004) [38]. - Việc ấp nở gia cầm phải được thực hiện theo sự hướng dẫn chỉ đạo của cơ quan chuyên mơn và các ngành chức năng. Chỉ được bán và vận chuyển gia cầm ra bên ngồi khi đã thực hiện việc vệ sinh phịng bệnh theo quy định cĩ sự giám sát và cho phép của cơ quan chuyên mơn thú y. Theo Lê Văn Năm (2004) [19] thì ở nước ta muốn khơng cĩ dịch bệnh cúm địi hỏi các cơ quan chức năng phải ngăn chặn bệnh từ xa bằng việc kiểm sốt chặt chẽ các loại động vật và sản phẩm động vật chăn nuơi nhập nội tại các cửa khẩu của đất nước và nếu ở đâu đĩ cĩ sự xuất hiện bệnh cúm thì phải khẩn trương làm sạch ổ dịch bằng các biện pháp cứng rắn nhất. * Một số vấn đề về sử dụng vaccin phịng cúm: Đại dịch cúm do virus độc lực cao subtype H5N1 gây ra hiện nay đã và đang lưu hành nhanh chĩng qua một loạt các nước ở châu Á trong đĩ cĩ Việt Nam, đang trở thành mối quan tâm Quốc tế đặc biệt. Số lượng lây nhiễm chủng virus cúm A – H5N1 ở người đã được cơng bố ngày càng tăng lên và kết cục thường dẫn đến tử vong. Điều đĩ địi hỏi phải cĩ biện pháp khống chế dịch bệnh một cách nhanh Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 44 chĩng nhằm giảm thiểu tối đa sự bùng phát dịch bệnh trên đàn gia cầm cũng như ở cộng đồng con người. Khi dịch cúm gia cầm xảy ra ở vùng cĩ mật độ nuơi cao, nơi mà các biện pháp an tồn sinh học nghiêm ngặt cho thấy khơng phù hợp với hệ thống chăn nuơi hiện đại thì tiêm chủng vaccin được coi là giải pháp hàng đầu để khống chế sự lây lan dịch bệnh (Ilaria Capua và Stefano Marangon, 2004) 31 . Các biện pháp khống chế, kiểm sốt dịch bệnh truyền thống tập trung và tiêu huỷ, khử trùng tiêu độc địi hỏi loại bỏ trên quy mơ lớn những đàn nhiễm bệnh và những đàn tiếp xúc với virus cúm. Những chính sách này đã cho kết quả rất tốt nhưng đặc biệt tốn kém, khơng triệt để trong tình trạng hiện nay. Mật độ chăn nuơi gia cầm cao, chăn nuơi nơng hộ vẫn rải rác trong các thơn xĩm khĩ kiểm sốt dẫn đến phải tiêu diệt hàng triệu con gia cầm các loại, gây ảnh hưởng đến vấn đề mơi trường và thiệt hại lớn về kinh tế cho người chăn nuơi (Trương Văn Dung và cộng sự, 2005) [9]. Tiêm phịng vaccin là một chiến lược hỗ trợ cĩ thể được cân nhắc khi bệnh đã lây lan ra một phạm vi nào đĩ mà nĩ đã vượt quá sự kiểm sốt của cơ quan chuyên mơn Thú y hoặc vượt quá mức chi phí dự kiến cho các chiến dịch tiêu huỷ rộng lớn. Tiêm phịng cũng cĩ thể được cân nhắc ở giai đoạn sớm hơn khi cơ sở hạ tầng và năng lực của ngành Thú y được ghi nhận là kém và khơng đủ sức ngăn chặn sự lây lan dịch bệnh (Tơ Long Thành, 2007) [28]. Theo FAO và OIE thì sử dụng các loại vaccin phịng cúm do OIE phê chuẩn cĩ thể bảo hộ tốt chống lại bệnh lâm sàng ở gà bằng cách làm giảm tỷ lệ chết và các thiệt hại về kinh tế khác. Việc dùng vaccin cho gia cầm cũng làm giảm lượng virus bài thải ra mơi trường và vì thế làm giảm nguy cơ truyền virus từ gia cầm sang người (Van der Goot và cộng sự, 2005) 49 . Kết quả chờ đợi từ việc áp dụng chiến lược tiêm phịng là làm giảm tính mẫn cảm của gia cầm đối với việc lây nhiễm (nghĩa là cần lượng virus Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 45 cao hơn nữa mới cĩ thể lây nhiễm) và làm giảm lượng virus bài thải ra mơi trường (Ilaria Capua và Stefano Marangon, 2004) 31 . Tiêm phịng bệnh cúm cho gia cầm đã được chứng minh là biện pháp hỗ trợ hiệu quả kết hợp với các biện pháp an tồn sinh học, biện pháp loại thải cĩ kiểm sốt tại một Quốc gia như ở Italia, Mehico, Pakistan, Hồng Kơng và Trung Quốc. Biện pháp tiêm phịng vaccin cĩ hai lợi thế cơ bản là: - Thứ nhất là vaccin làm giảm sự cảm nhiễm bệnh đối với gia cầm đã được tiêm phịng. - Thứ hai là làm giảm đáng kể lượng virus bài thải ra mơi trường bên ngồi ở gia cầm đã được tiêm phịng. Như vậy virus ơ nhiễm mơi trường ít nên giảm nguy cơ lây nhiễm sang đàn gia cầm khác, đồng thời làm giảm nguy cơ lây nhiễm cho con người và giảm cơ hội cho virus biến chủng tạo thành chủng virus cúm mới ở người (Trương Văn Dung và cộng sự, 2005) [9]. Các tổ chức y tế Quốc tế đã khảo sát sự lây lan của virus cúm dọc Đơng Nam châu Á và kết luận rằng virus đã “đĩng chốt” rất sâu ở khắp nơi, khơng cĩ hy vọng tiêu diệt mà chỉ cĩ thể khống chế nĩ (Tơ Long Thành, 2004) [26]. Khi mầm bệnh vẫn cịn tiềm ẩn và dịch cúm A (H5N1) ở người vẫn tiếp tục xuất hiện ở một số địa phương và đang cĩ dấu hiệu diễn biến phức tạp. Đồng thời với việc thực hiện đồng bộ các biện pháp về sinh học, vệ sinh mơi trường (tiêu độc, khử trùng) trong phịng chống dịch cúm gia cầm thì việc tiêm vaccine phịng dịch cúm là một trong những biện pháp nhằm tiêu diệt mầm bệnh (Thủ Tướng Chính Phủ, 2005) [29]. Theo những khuyến cáo hiện nay của OIE thì gia cầm đã được tiêm phịng chống lại bệnh cúm gia cầm thể độc lực cao được phép xuất khẩu mặc dù phải tuân theo những hướng dẫn kỹ thuật cụ thể nhằm đảm bảo rằng vaccin được sử dụng đúng quy trình và gia cầm được giám sát đúng quy định. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 46 Việc sử dụng vaccin khi được thực hiện phải được tiến hành kết hợp với các biện pháp phịng chống khác bao gồm cả việc tiêu huỷ các đàn bị bệnh. Tuy nhiên, vì lý do an tồn, các nhà khoa học khuyến cáo rằng những vùng cĩ nguy cơ lây nhiễm rộng, chủng virus cĩ độc lực trung gian hoặc trong những trường hợp cần thiết phải dùng vaccin thì vaccin vơ hoạt là sự lựa chọn tốt nhất (Trần Xuân Hạnh, 2004) [14]. Mặc dù vậy, theo Tơ Long Thành (2004) [25] thì các kết quả nghiên cứu gần đây cho thấy, việc sử dụng vaccin phịng cúm cho gia cầm lại làm tăng khả năng xuất hiện đại dịch ở người. Chỉ cĩ việc giám sát chặt chẽ đàn gia cầm được dùng vaccin mới cĩ thể ngăn chặn được hiện tượng này. Cũng theo Tơ Long Thành (2004) [25], trong bài báo đăng trên tạp trí virus học, Suarez và cộng tác viên đã phát hiện cĩ những sự thay đổi kháng nguyên đáng kể của các virus cúm phân lập từ gà sử dụng vaccin Mehico từ năm 1995. Càng ngày càng cĩ sự sai khác giữa các chủng virus cúm phân lập được từ gà so với chủng virus sử dụng làm vaccin, điều đĩ cĩ nghĩa là gà được tiêm phịng sẽ bài thải virus nhiều hơn và bệnh sẽ lây lan nhanh hơn. Từ những địi hỏi cấp thiết của tình hình thực tế dịch bệnh cúm gia cầm trong nước. Trên cơ sở khoa học và những ý kiến của các nhà chuyên mơn, qua thử nghiệm thực tế sử dụng vaccin phịng bệnh cúm cho đàn gia cầm trong nước, Ban chỉ đạo Quốc gia về phịng chống bệnh cúm gia cầm đã quyết định: “Sử dụng vaccin phịng bệnh cúm gia cầm như là một vũ khí quan trọng hộ trợ tích cực cho việc khống chế dịch bệnh tại Việt Nam”. * Một số loại vaccin phịng cúm và cách sử dụng: Các lồi gia cầm trong diện tiêm bao gồm các loại gà như gà giống, gà trứng thương phẩm, gà chọi và gà thịt. Các loại vịt như vịt giống, vịt đẻ trứng thương phẩm và vịt thịt. Các loại ngan như ngan giống, ngan đẻ trứng thương phẩm và ngan thịt, kể cả ngỗng (Bộ Nơng nghiệp và phát triển nơng thơn, 2007) [4]. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 47 Một số loại vaccin đang sử dụng hiện nay là vaccin Trovac – AIVH5, vaccin chết chủng H5 Trung Quốc, vaccin H5N9 Trung Quốc, vaccin TROVAC – ALVH5 (Bộ Nơng nghiệp và phát triển nơng thơn, 2007) [4]. - Đối với gà và vịt: Gà 1 ngày tuổi sử dụng vaccin Trovac – AIVH5 nhỏ mắt, mũi. Vaccin chết chủng H5N1 của Trung Quốc tiêm cho gà và vịt từ 15 ngày tuổi trở lên. Gà tiêm 1 mũi và sau 4 tháng tiêm nhắc lại, gà từ 15 – 34 ngày tuơi tiêm 0,3ml vào da cổ, gà từ 35 ngày tuơi trở lên tiêm 0,5ml vào cơ ngực. Vịt tiêm 2 mũi cách nhau 4 tuần và 4 tháng sau tiêm nhắc lại, vịt 15-34 ngày tuổi tiêm 0,5ml vào da cổ, vịt 35 ngày tuổi trở lên tiêm 1ml vào cơ ngực. Riêng ngỗng tiêm mũi hai 1,5ml. - Đối với ngan: Sử dụng vaccin H5N9 tiêm cho ngan từ 21 ngày tuổi trở lên, mũi 2 cách mũi 1 sau 4 tuần và 4 tháng sau tiêm nhắc lại. Đối với vaccin TROVAC-ALVH5 là vaccin ở dạng đơng khơ tiêm dưới da 0,2ml cho gà 1 ngày tuổi nuơi thịt theo phương thức nuơi cơng nghiệp cĩ tác dụng tạo miễn dịch phịng bệnh cúm trong 20 tuần và miễn dịch chống bệnh đậu gà trong 10 tuần kể từ sau khi tiêm (Bộ Nơng nghiệp và phát triển nơng thơn, 2007) [4]. Vaccin phải được bảo quản trong tủ lạnh ở nhiệt độ từ 2 – 8oC (khơng để trong ngăn đá), vận chuyển trong tủ xốp hoặc bình bảo ơn lạnh. Trước khi tiêm phải để chai vaccin ra ngồi để đảm bảo nhiệt độ vaccin bằng nhiệt độ mơi trường khoảng 25oC và lắc kỹ chai vaccin trước khi tiêm. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 48 Chƣơng 2 ĐỐI TƢỢNG - VẬT LIỆU - NỘI DUNG VÀ PHƢƠNG PHÁP NGHIÊN CỨU 2.1. Đối tƣợng và vật liệu dùng trong nghiên cứu 2.1.1. Đối tượng nghiên cứu - Các hộ và trại chăn nuơi gà, vịt và ngan tại Thái Nguyên. - Mẫu bệnh phẩm dùng trong nghiên cứu là dịch ngốy họng hay ổ nhớp và huyết thanh của gia cầm. 2.1.2. Vật liệu dùng trong nghiên cứu - Bệnh phẩm phát hiện kháng thể cúm H5 là huyết thanh của gia cầm chưa được tiêm vaccine phịng cúm. - Dịch ngốy họng hay ổ nhớp (swab) của gia cầm để phát hiện virus. - Bệnh phẩm phát hiện kháng thể là huyết thanh của gia cầm đã tiêm vaccin sau 21 ngày để xác định khả năng gây miễn dịch của vaccin. - Các loại mơi trường, hố chất, dụng cụ và máy mĩc khác như các loại tủ lạnh, tủ ấm, nồi đun, buồng cấy, máy hút chân khơng, máy ly tâm, máy trộn ống nghiệm, máy lắc đĩa, máy nhân gen, hệ thống điện di, buồng thao tác PCR, xilanh, bình bảo ơn .... - Vaccin phịng cúm cho gia cầm chủng H5N1 do Trung Quốc sản xuất tiêm cho cả gà và vịt (gà tiêm một mũi, vịt tiêm hai mũi). - Động vật thí nghiệm: Gà, vịt, ngan nuơi tại Thái Nguyên. 2.2. Nội dung nghiên cứu 2.2.1. Thực trạng chăn nuơi và kiểm tra vệ sinh thú y - Điều tra tỷ lệ hộ chăn nuơi gia cầm và quy mơ đàn nuơi trong các nơng hộ và các cơ sở chăn nuơi tại tỉnh Thái Nguyên. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 49 - Điều tra các phương thức chăn nuơi gia cầm chủ yếu tại Thái Nguyên như nuơi nhốt, nuơi chăn thả, bán chăn thả. - Tỷ lệ hộ chăn nuơi gia cầm cĩ tiêm phịng một số bệnh truyền nhiễm chủ yếu như cúm, newcastle, tụ huyết trùng, dịch tả. - Thực trạng kiểm dịch, kiểm sốt giết mổ, kiểm tra vệ sinh thú y trong giết mổ và lưu thơng gia cầm tại tỉnh Thái Nguyên. 2.2.2. Một số đặc điểm dịch tễ của bệnh cúm gia cầm - Biến động tỷ lệ xuất hiện bệnh cúm gia cầm theo lồi, theo phương thức chăn nuơi và theo quy mơ đàn nuơi trong những năm qua (từ tháng 1/2004 – 15/2/2008). - Xác định sự lưu hành virus cúm theo lồi, theo phương thức chăn nuơi và theo quy mơ đàn nuơi. 2.2.3. Xác định hiệu giá kháng thể ở gia cầm sau khi tiêm phịng vaccin 21 ngày 2.3. Phƣơng pháp nghiên cứu 2.3.1. Phương pháp nghiên cứu dịch tễ - Sử dụng phương pháp nghiên cứu dịch tễ học của Nguyễn Như Thanh (2001) [23], cụ thể như sau: + Lập biểu điều tra. + Điều tra tình hình chăn nuơi, lưu thơng và giết mổ gia cầm tại tỉnh Thái Nguyên: Điều tra trực tiếp tận hộ chăn nuơi, kinh doanh và giết mổ gia cầm, kết hợp với việc sử dụng số liệu Kiểm dịch - Kiểm sốt giết mổ - Kiểm tra vệ sinh Thú y của Chi cục Thú y tỉnh Thái Nguyên. + Điều tra phương thức chăn nuơi gia cầm chủ yếu của tỉnh Thái Nguyên: Chọn 3 huyện là Định Hố, Thành phố Thái Nguyên và huyện Phú Bình đại diện cho các tập quán chăn nuơi chủ yếu và vùng địa lý điển hình Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 50 của tỉnh. Mỗi huyện chọn ngẫu nhiên 3 xã, mỗi xã chọn 3 thơn và phát phiếu điều tra. Với huyện Định Hố gồm các xã Tân Thịnh, Chợ Chu và Đồng Thịnh. Thành phố Thái Nguyên cho vùng trung du gồm các xã, phường là Lương Sơn, Tân Thành và Thịnh Đán. Huyện Phú Bình gồm các xã Dương Thành, Tân Khánh và Nhã Lộng. 2.3.2. Phương pháp RT – PCR (Bộ Nơng nghiệp và phát triển nơng thơn, 2005) [2]: * Nguyên liệu cho phản ứng RT – PCR gồm: Kít chiết tách RNA của virus. Kít RT - PCR OneStep Qiagen. Thạch điện di. Marker (100 bp DNA ladder). RNA đối chứng dương tính. PBS 0,01M pH 7,2. Nước cất đã xử lý DEPC và primer H5 do Nhật Bản cung cấp: H5 – 515F: CATACCCAACAATAAAGAGG H5 – 1220R: GTGTTCATTTTGTTAATGAT * Chiết tách RNA: Chiết tách RNA bằng phương pháp Trizol. + Cho 0,75ml Trizol LS reagent (hoặc 1ml Trizol reagent) + 0,25ml dịch bệnh phẩm (0,1ml dịch bệnh phẩm nếu dùng Trizol reagent) vào ống 1,5ml, lắc đều và để ở nhiệt độ phịng 5 phút. + Thêm 0.2ml chloroform vào ống. Lắc mạnh trong 15 giây và để ở nhiệt độ phịng 5 phút. + Ly tâm ống ở tốc độ 12.000 vịng/phút trong 15 phút ở 4oC. + Chuyển phần nước (khoảng 500µl) sang ống microtube mới. + Thêm 0.5ml Isopropanol và lắc đều. Để 5 – 10 phút ở nhiệt độ phịng. + Ly tâm ống ở tốc độ 10.000 vịng/phút trong 5 phút ở 4oC. Bỏ dung dịch đi. + Rửa RNA đĩng ở đáy ống bằng cồn 80%, lắc mạnh và ly tâm ống ở tốc độ 10.000 vịng/phút trong 5 phút ở 4oC. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 51 + Bỏ dung dịch trong ống và làm khơ RNA 10 phút ở nhiệt độ phịng và hồ tan với 30µl nước cất khơng cĩ Rnase hoặc nước cất đã xử lý DEPC. * Tiến hành phản ứng: - Cơng thức pha: H2O 12 µl 5X Buffer 5 µl dNTP 1 µl Enzyme mix 1 µl Primer forword 0,5 µl Primer reverse 0,5 µl Mẫu RNA 5 µl Tổng cộng 25 µl - Chu trình nhân gen: 1) 60 o C – 1 phút. 2) 42 o C – 10 phút. 3) 50 o C – 30 phút. 4) 95 o C – 15 phút. 5) 94 o C – 30 giây (tách sợi). 6) 50 o C – 30 giây (gắn primer). 7) 72 o C – 1 phút (kéo dài). 8) Chu trình 35 – 40 vịng. 9) 72 o C – 10 phút. 10) Giữ ở 4oC. * Chạy điện di: - Chuẩn bị thạch agarose 1,5% pha trong dung dịch TAE hoặc TBE cĩ Ethidium Bromide (10µg/µl). Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 52 - Đổ thạch vào khuơn điện di (cĩ lược). - Thạch khơ, rút lược ra và cho mẫu vào các giếng (5µl sản phẩm PCR + 2µl dung dịch loading buffer). - Sử dụng Marker trọng lượng phân tử (thang 100bp). - Khi chạy PCR phải cĩ mẫu đối chứng dương và đối chứng âm đi kèm (mẫu đối chứng âm tính cĩ thể là nước cất sạch). - Điều kiện chạy điện di: Cường độ dịng điện 400 ampe. Hiệu điện thế từ 80 – 100V. Thời gian 70 phút. - Nhuộm với Ethidium Bromide trong 30 phút. * Quan sát kết quả và đọc kết quả: Mẫu swab dương tính khi thấy xuất hiện vạch giống với mầu đối chứng dương tính. Mẫu âm tính khi khơng cĩ vạch. Đánh giá kết quả: Cĩ virus cúm hoặc virus cúm thuộc subtype nào dựa vào primer chạy mẫu. 2.3.3. Phản ứng ngưng kết hồng cầu gián tiếp (HI) (Bộ Nơng nghiệp và phát triển nơng thơn, 2005) [2]: * Chuẩn bị nguyên liệu cho phản ứng: + Huyết thanh gà, vịt, ngan cần xét nghiệm. + Kháng nguyên chuẩn H5. + Men xử lý huyết thanh RDE. + Hồng cầu gà 0,5%. + Kháng sinh. * Tiến hành phản ứng: Huyết thanh kiểm tra: Huyết thanh gà khơng xử lý bằng RDE, huyết thanh vịt xử lý bằng RDE chống hiện tượng ngưng kết hồng cầu khơng đặc hiệu và xử lý hồng cầu chống hiện tượng ngưng kết hồng cầu giả. + Xử lý huyết thanh vơ hoạt yếu tố ức chế khơng đặc hiệu: Trộn 3 phần RDE với 1 phần kháng huyết thanh, ủ ở 37oC trong nồi đun cách thuỷ qua Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 53 đêm. Sau đĩ ủ tiếp ở nồi đun cách thuỷ 56oC/30 phút để vơ hoạt RDE cịn dư. Kháng huyết thanh đã xử lý để nguội rồi cho thêm 6 phần nước muối sinh lý (0,3ml huyết thanh + 1,8ml nước muối sinh lý), độ pha lỗng kháng huyết thanh cuối cùng sẽ là 1/10. + Xử lý huyết thanh chống hiện tượng ngưng kết hồng cầu giả bằng cách hấp phụ huyết thanh kiểm tra với hồng cầu gà. Thêm 25µl hồng cầu đặc vào 500µl huyết thanh, lắc nhẹ và để ở nhiệt độ phịng trong 30 phút, sau đĩ ly tâm với tốc độ 800 vịng trong 2 – 5 phút. Thu lấy huyết thanh đã hấp phụ. - Phản ứng HI: + Nhỏ 25µl PBS vào các giếng của đĩa 96 giếng. + Pha lỗng huyết thanh theo cơ số 2. + Nhỏ 25µl huyết thanh vào giếng đầu tiên rồi trộn đều. + Rút chuyển 25µl từ giếng 1 sang giếng 2 rồi tuần tự như vậy đến giếng 11 và bỏ đi 25µl cuối cùng. + Nhỏ 25µl kháng nguyên 4HA đã chuẩn bị vào các giếng từ 1 – 11. Thêm 25µl PBS vào hàng đối chứng hồng cầu (giếng 12). + Lắc đĩa và ủ ở nhiệt độ phịng 30 phút. + Nhỏ 25µl dung dịch hồng cầu vào tất cả các giếng của đĩa và lắc đều. + Để đĩa ở nhiệt độ phịng 40 phút rồi đọc kết quả. Phản ứng dương tính (+): Huyết thanh cĩ kháng thể cúm H5 khi cĩ hiện tượng ngăn trở ngưng kết hồng cầu (hồng cầu tụ lại dưới đáy giếng). Hiệu giá HI của mẫu được tính ở độ pha lỗng huyết thanh cao nhất cịn cĩ khả năng ngăn trở ngưng kết hồng cầu hồn tồn. Huyết thanh được coi là dương tính khi cĩ hiệu giá huyết thanh lớn hơn hoặc bằng ( ) 1/16. Huyết thanh đối chứng âm phải cĩ hiệu giá nhỏ hơn hoặc bằng ( ) 1/4. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 54 Khi kiểm tra huyết thanh vịt thì sẽ cĩ 1 giếng chỉ cĩ huyết thanh và hồng cầu để kiểm tra hiện tượng ngưng kết hồng cầu khơng đặc hiệu. Nếu phát hiện thấy cĩ hiện tượng ngưng kết hồng cầu khơng đặc hiệu xảy ra với mẫu huyết thanh nào thì sẽ xử lý mẫu huyết thanh đĩ và kiểm tra lại bằng phản ứng HI. Phản ứng HI tìm kháng thể cúm H5 trong huyết thanh của gia cầm chưa được tiêm vaccine phịng cúm. Theo Nguyễn Tiến Dũng (2006) [12], Trương Văn Dung và cộng sự (2005) [9], nếu dương tính với kháng thể cúm H5 là gián tiếp khẳng định đã cĩ sự lưu hành virus trong cơ thể gia cầm. 2.4. Phƣơng pháp lấy mẫu - Đối tượng lấy mẫu là gà, vịt và ngan đang được nuơi tại Thái Nguyên. - Mẫu giám sát sự lưu hành virus là huyết thanh của gia cầm chưa được tiêm vaccine phịng cúm và dịch ngốy họng hay ổ nhớp (swab) của gia cầm. * Phương pháp lấy mẫu swab: Dùng tăm bơng vơ trùng ngốy vào ổ nhớp hoặc họng của gia cầm đến khi ướt hết đầu bơng mới rút ra và bỏ vào lọ thuỷ tinh sạch vơ trùng cĩ chứa 1-2ml dung dịch đẳng trương cĩ pH từ 7 - 7,4 và cĩ chứa kháng sinh liều cao để hạn chế sự phát triển của vi khuẩn. Đồng thời phải được bảo quản và vận chuyển trong bình bảo ơn lạnh vơ trùng. Mẫu được lấy theo phương thức chăn nuơi chủ yếu, ở gà là nuơi nhốt, bán chăn thả và chăn thả, ở vịt và ngan là nuơi nhốt và nuơi bán chăn thả. Đối với mẫu swab, mỗi đàn gia cầm lấy 05 mẫu gộp thành 1 mẫu xét nghiệm. - Mẫu huyết thanh để xác định hàm lượng kháng thể là huyết thanh của gia cầm đã được tiêm vaccin phịng cúm sau ít nhất 21 ngày. * Phương pháp lấy mẫu huyết thanh: Nhổ hết lơng tại vị trí lấy máu trên cánh của gia cầm. Sát trùng bằng bơng cồn. Dùng bơm tiêm loại 5ml trọc kim vào tĩnh mạch theo chiều hướng đầu kim vào phía trong cơ thể gia cầm, Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 55 lấy từ 1 – 2ml máu/con, sau đĩ kéo dài tay bơm ra đến khoảng 5ml, bẻ gập đầu kim rồi đậy nắp kim lại, để bơm tiêm nằm ngang cho máu đơng. - Mỗi gia cầm chỉ được lấy một mẫu và cĩ ghi rõ địa chỉ chủ nuơi, ngày lấy mẫu, lồi lấy mẫu, tổng số mẫu lấy, tuổi gia cầm lấy mẫu. 2.5. Phƣơng pháp xử lý số liệu Sử dụng phương pháp dịch tễ học của Nguyễn Như Thanh (2001) [23], những số liệu thu được của đề tài sẽ được xử lý trên máy vi tính và ứng dụng phương pháp tốn thống kê sinh vật học. Cụ thể như sau: - Cách tính hiệu giá kháng thể: Hiệu giá HI của mẫu được tính ở độ pha lỗng huyết thanh cao nhất cịn cĩ khả năng ngăn trở ngưng kết hồng cầu hồn tồn. Độ pha lỗng huyết thanh lần 1 là 1/2; lần 2 là 1/4, tiếp theo là 1/8, 1/16, 1/32, 1/64, 1/128, 1/256, 1/512, 1/1024, 1/2048, 1/4096 …. Huyết thanh được coi là dương tính khi cĩ hiệu giá huyết thanh lớn hơn hoặc bằng (≥) 1/16 tức là bằng 4log2, tiếp theo 1/32 bằng 5log2, 6log2, 7log2, 8log2, 9log2, 10log2, 11log2, 12log2…. Huyết thanh đối chứng âm phải cĩ hiệu giá kháng thể nhỏ hơn hoặc bằng (≤) 1/4. Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 56 Chƣơng 3 KẾT QUẢ VÀ THẢO LUẬN 3.1. Thực trạng chăn nuơi và kiểm tra vệ sinh thú y trong lƣu thơng, giết mổ gia cầm tại Thái Nguyên Với mục đích đánh giá về đặc điểm dịch tễ của bệnh và ảnh hưởng của phương thức chăn nuơi đến cơng tác phịng chống dịch cúm, từ ngày 7 đến 12 tháng 8 năm 2007 chúng tơi đã tiến hành điều tra về thực trạng chăn nuơi gia cầm ở một số huyện, thành của tỉnh Thái Nguyên. 3.1.1. Thực trạng chăn nuơi gia cầm ở một số huyện, thành của tỉnh Thái Nguyên 3.1.1.1. Tỷ lệ các nơng hộ chăn nuơi gia cầm Bảng 3.1. TÌNH HÌNH CHĂN NUƠI GIA CẦM Ở MỘT SỐ HUYỆN, THÀNH CỦA TỈNH THÁI NGUYÊN Địa danh (Huyện, thành) Số hộ đ.tra Số hộ nuơi Tỷ lệ (%) Số đàn gia cầm Gà Vịt Ngan Số hộ Tỷ lệ (%) Số hộ Tỷ lệ (%) Số hộ Tỷ lệ (%) Định Hố 635 629 99,1 682 629 100 33 5,2 20 3,2 Thái Nguyên 738 512 69,4 561 512 100 33 6,4 16 3,1 Phú Bình 779 763 97,9 795 763 100 24 3,1 8 1,0 Tính chung 2.152 1.904 88,5 2.038 1.904 100 90 4,7 44 2,3 Trong 2.152 hộ điều tra ở 3 huyện, thành cĩ 1.904 hộ chăn nuơi gia cầm bằng 88,5% với 2.038 đàn gia cầm, cao hơn mức trung bình của cả nước so với thống kê của Hồng Kim Giao và Nguyễn Thanh Sơn (2005) [13] tới 8,5% do Thái Nguyên là tỉnh trung du miền núi, phần lớn người dân làm nơng nghiệp nên thuận lợi cho phát triển chăn nuơi, ngồi ra nơi điều tra cũng là những địa phương cĩ ngành chăn nuơi gia cầm phát triển. Điều này cho thấy Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 57 Thái Nguyên vẫn là tỉnh cĩ tỷ lệ hộ chăn nuơi gia cầm khá phổ biến. Cả 1.904 hộ điều tra đều nuơi gà, 90 hộ nuơi vịt bằng 4,7% và 44 hộ nuơi ngan bằng 2,3%. Riêng đàn vịt và ngan giảm rất nhiều so với thống kê của Cục Thống kê Thái Nguyên ngày 1/8/2007 do nơi điều tra là những xã phường cĩ ngành chăn nuơi gà phát triển. Điều tra 3 xã của huyện Định Hố là Tân Thịnh, Chợ Chu và Đồng Thịnh cho thấy, đây là 3 xã điển hình cho vùng địa lý của huyện, chủ yếu là đồi núi thấp và dốc, diện tích tự nhiên khá rộng, thuận lợi cho việc chăn nuơi gia cầm. Với số hộ làm nơng nghiệp chiếm tỷ lệ rất cao, nền kinh tế nĩi chung cịn gặp nhiều khĩ khăn, đa số người dân khơng cĩ nghề phụ nên chủ yếu làm nơng nghiệp và phát triển chăn nuơi. Trong 635 hộ điều tra cĩ 629 hộ chăn nuơi với 682 đàn gia cầm, chiếm 99,1% và cĩ 41 hộ chăn nuơi từ 2 lồi trở lên. Đây là tỷ lệ đặc trưng cho các huyện vùng núi của tỉnh. Đối với Thành phố Thái Nguyên, điều tra 3 xã, phường là Thịnh Đán, Tân Thành và Lương Sơn, đây là những xã phường nằm bao quanh Thành phố nên một số khơng nhỏ người dân là Cán bộ cơng nhân viên chức và làm dịch vụ hoặc cĩ nghề phụ nên số hộ cĩ chăn nuơi gia cầm là khơng lớn, chỉ cĩ 512 hộ chiếm 69,4% với 561 đàn gia cầm trong 738 hộ điều tra và cĩ 36 hộ nuơi từ 2 lồi trở lên. Đây là trung tâm kinh tế, chính trị và văn hố của tỉnh chủ yếu phát triển cơng nghiệp và dịch vụ thì tỷ lệ này vẫn là khá cao. Tại huyện Phú Bình, điều tra 3 xã là Dương Thành, Nhã Lộng và Tân Khánh, đây là huyện đồng bằng trung du thuần nơng nên cĩ tỷ lệ hộ chăn nuơi gia cầm khá lớn. Trong 779 hộ điều tra cĩ 763 hộ chăn nuơi, chiếm 97,9 với 795 đàn gia cầm và cĩ 31 hộ nuơi từ 2 lồi trở lên, tỷ lệ này đặc trưng cho các huyện phía Nam của tỉnh. Trong 629 hộ nuơi gia cầm của huyện Định Hố thì cả 629 hộ cĩ nuơi gà. Cĩ 33 hộ nuơi vịt bằng 5,2% và 20 hộ nuơi ngan bằng 3,2%, trong đĩ cĩ 6,5% hộ nuơi từ 2 lồi trở lên. Đối với Thành phố Thái Nguyên, trong 512 hộ Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 58 nuơi gia cầm thì tất cả số hộ này đều nuơi gà, cĩ 33 hộ nuơi vịt bằng 6,4% và 16 hộ nuơi ngan bằng 3,1%, cĩ 7% hộ nuơi từ 2 lồi trở lên. Cũng như vậy, cả 763 hộ nuơi gia cầm của huyện Phú Bình đều nuơi gà, cĩ 24 hộ nuơi vịt bằng 3,1% và 8 hộ nuơi ngan bằng 1,0%, cĩ 4,1% hộ nuơi từ 2 lồi trở lên. Như vậy, tỷ lệ hộ chăn nuơi gia cầm đã tăng khoảng 8%, đặc biệt là đối với chăn nuơi gà, và cĩ 5,7% hộ nuơi từ 2 lồi trở lên. Với tình hình như hiện nay, nếu chính quyền địa phương và các ngành chức năng khơng cĩ những kế hoạch phát triển kịp thời và định hướng lâu dài phù hợp cho từng địa phương và người chăn nuơi thì đây sẽ là một nguy cơ làm phát tán và lây lan dịch bệnh, đặc biệt là dịch cúm gia cầm. 3.1.1.2. Quy mơ đàn nuơi trong các nơng hộ ở một số huyện, thành Bảng 3.2. QUY MƠ ĐÀN GÀ NUƠI TRONG CÁC NƠNG HỘ Địa danh (Huyện, thành) Số đàn nuơi Quy mơ đàn nuơi (con) 500 Số đàn (%) Số đàn (%) Số đàn (%) Định Hố 629 511 81,3 118 18,7 - - Thái Nguyên 512 413 80,7 86 16,8 13 2,5 Phú Bình 763 631 82,7 124 16,3 8 1,0 Tính chung 1.904 1.555 81,7 328 17,2 21 1,1 Kết quả ở bảng 2 cho thấy, quy mơ chăn nuơi gà trong các nơng hộ ở một số địa phương của tỉnh Thái Nguyên chủ yếu là nhỏ lẻ và phân tán. Ở quy mơ chăn nuơi dưới 200 con/hộ thì cĩ 1.555 hộ, chiếm 81,7% trong tổng 1.904 hộ chăn nuơi gà điều tra. Ở quy mơ từ 200 – 500 con/hộ cĩ 328 hộ, chiếm 17,2%, quy mơ trên 500 con/hộ chỉ cĩ 21 hộ bằng 1,1% vì đây là quy mơ chăn nuơi tập trung mang tính cơng nghiệp là chủ yếu. Trong đĩ ở quy mơ chăn nuơi dưới 200 con/hộ thì cả 3 huyện, thành đều cĩ tỷ lệ tương đối giống Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 59 nhau: Tại huyện Định Hố là 511/629 hộ bằng 81,3%, Thành phố Thái Nguyên là 413/512 hộ bằng 80,7% và huyện Phú Bình là 631/763 hộ bằng 82,7%. Kết quả này cho thấy, tuy cĩ thấp hơn nhưng so với huyện vùng núi và các huyện phía nam của tỉnh thì tỷ lệ này của Thành phố Thái Nguyên vẫn là tương đối cao. Ở quy mơ từ 200 – 500 con/hộ cũng khơng khác nhau nhiều với 118 hộ bằng 18,7% ở huyện Định Hố, 86 hộ bằng 16,8% ở Thành phố Thái Nguyên và 124 hộ bằng 16,3% ở huyện Phú Bình. Riêng quy mơ chăn nuơi trên 500 con/hộ thì ở huyện Định Hố, trong số 629 hộ điều tra khơng cĩ hộ nào nuơi đến 500 con gà, cịn Thành phố Thái Nguyên thì tỷ lệ này lại tăng đáng kể so với các huyện thành khác với 13 hộ bằng 2,5% và huyện Phú Bình là 8 hộ bằng 1%. Điều này cho thấy thực trạng của ngành chăn nuơi gà tại tỉnh Thái Nguyên cũng như các tỉnh miền núi phía Bắc Nước ta cịn lạc hậu, trình độ chăn nuơi chậm phát triển do nền kinh tế của người chăn nuơi cịn nghèo và chủ yếu là chăn nuơi tự phát theo tập quán cũ mang tính tự cung tự cấp. Như vậy, ngành chăn nuơi gà trong các nơng hộ của tỉnh Thái Nguyên chủ yếu là chăn nuơi thủ cơng và phân tán, chăn nuơi ở quy mơ từ 500 con trở lên là khơng đáng kể (1,1%), chủ yếu tập trung ở Thành phố Thái Nguyên và các huyện phía Nam nên sẽ gây rất nhiều khĩ khăn cho việc quản lý cũng như thực hiện các biện pháp phịng chống dịch bệnh. Bảng 3.3. QUY MƠ ĐÀN VỊT NUƠI TRONG CÁC NƠNG HỘ Địa danh (Huyện, thành) Số đàn nuơi Quy mơ đàn nuơi (con) 500 Số đàn (%) Số đàn (%) Số đàn (%) Định Hố 33 33 100 - - - - Thái Nguyên 33 31 94,0 1 3,0 1 3,0 Phú Bình 24 19 79,2 3 12,5 2 8,3 Tính chung 90 83 92,2 4 4,5 3 3,3 Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 60 Đối với đàn vịt, trong 90 đàn nuơi điều tra thì quy mơ đàn dưới 200 con/hộ cĩ 83 hộ bằng 92,2%, ở quy mơ từ 200 – 500 con/hộ của cả ba đơn vị điều tra cĩ 4 trong 90 hộ cĩ nuơi vịt bằng 4,5%, cịn ở quy mơ trên 500 con cũng chỉ với 3 hộ và bằng 3,3%. Trong đĩ huyện Định Hố cĩ 33 hộ nuơi vịt thì cả 33 hộ này đều cĩ quy mơ đàn dưới 200 con và chủ yếu là nuơi nhỏ lẻ mang tính tự cung tự cấp. Cũng 33 hộ nuơi vịt tại Thành phố Thái Nguyên thì cĩ 31 hộ nuơi ở quy mơ dưới 200 con chiếm 94%, chỉ cĩ 1 hộ nuơi ở quy mơ từ 200 – 500 con bằng 3% và 1 hộ nuơi ở quy mơ trên 500 con và cũng bằng 3%. Với địa hình đồng bằng và trung du thuận lợi cho phát triển chăn nuơi vịt nên huyện Phú Bình cĩ số hộ nuơi tuy khơng nhiều nhưng tổng đàn và quy mơ chăn nuơi lại khá lớn. Tổng số hộ nuơi vịt điều tra là 24, trong đĩ cĩ 19 hộ nuơi ở quy mơ dưới 200 con chiếm 79,2%, ở quy mơ từ 200 – 500 con cĩ 3 hộ bằng 12,5% và trên 500 con cĩ 2 hộ bằng 8,3%. Như vậy, đàn vịt nuơi ở tỉnh Thái Nguyên phần lớn là nhỏ lẻ, quy mơ đàn lớn chủ yếu tập trung ở huyện Phú Bình và Thành phố Thái Nguyên. Đặc biệt ở quy mơ dưới 200 con, với tỷ lệ 94% ở Thành phố Thái Nguyên, thấp hơn ở Định Hố (100%) nhưng vẫn cao hơn so với Phú Bình (79,2%) khi trình độ chăn nuơi và trình độ dân trí nơi đây cao hơn các địa phương khác. Bảng 3.4. QUY MƠ ĐÀN NGAN NUƠI TRONG CÁC NƠNG HỘ Địa danh (Huyện, thành) Số đàn nuơi Quy mơ đàn nuơi (con) 500 Số đàn (%) Số đàn (%) Số đàn (%) Định Hố 20 20 100 - - - - Thái Nguyên 16 15 93,7 - - 1 6,3 Phú Bình 8 5 62,5 2 25,0 1 12,5 Tính chung 44 40 91,0 2 4,5 2 4,5 Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 61 Trong 1.904 hộ chăn nuơi gia cầm điều tra chỉ cĩ 44 hộ nuơi ngan bằng 2,3% thấp hơn nhiều so với đàn vịt và gà nên nĩi chung quy mơ đàn ngan nuơi cũng là khơng lớn. Trong đĩ cĩ 40 hộ nuơi ngan ở quy mơ dưới 200 con bằng 91%, cĩ 2 hộ nuơi ở quy mơ từ 200 – 500 con chiếm 4,5%, cĩ 2 hộ nuơi ở quy mơ trên 500 con bằng 4,5% tổng số hộ nuơi điều tra. Đối với huyện Định Hố thì tỷ lệ số hộ nuơi ngan tuy lớn hơn hai huyện, thành nêu trên nhưng quy mơ chăn nuơi lại rất nhỏ lẻ, cả 20 hộ cĩ nuơi ngan đều ở quy mơ dưới 200 con, và bình quân chỉ vào khoảng 12 – 13 con/hộ. Trong 16 hộ nuơi ngan của Thành phố Thái Nguyên cĩ 1 hộ nuơi ở quy mơ trên 500 con chiếm 6,3%, ở quy mơ dưới 200 con cĩ 15 hộ bằng 93,7%, ở quy mơ từ 200 – 500 con thì khơng cĩ hộ nào. Riêng huyện Phú Bình, trong 763 hộ chăn nuơi gia cầm cĩ 8 hộ chăn nuơi ngan nhưng ở quy mơ đàn dưới 200 con cĩ 5 hộ bằng 62,5%, thấp hơn rất nhiều so với thành phố Thái Nguyên (93,7%), đặc biệt là so với huyện Định Hố (100%), ở quy mơ từ 200 – 500 con cĩ 25% và quy mơ trên 500 con cĩ 12,5% và ở hai quy mơ này chủ yếu là nuơi ngan sinh sản. Từ những kết quả nêu trên cĩ thể nhận thấy tỷ lệ hộ chăn nuơi gà, vịt và ngan là rất khác nhau. Trong 1.904 hộ điều tra cĩ chăn nuơi gia cầm thì cả 1.904 hộ đều nuơi gà, đặc biệt là chỉ cĩ 4,7% số hộ điều tra nĩi trên cĩ nuơi vịt và 2,3% là nuơi ngan. Như vậy đã cĩ 108 hộ nuơi chung từ 2 lồi trở lên. Ngồi những nguyên nhân do dịch bệnh, giá cả thức ăn và thị trường tiêu thụ thì cịn một nguyên nhân nữa khiến cho tỷ lệ hộ chăn nuơi ngan vịt giảm sút so với những năm trước đây cĩ thể được nhắc đến là do Thái Nguyên là tỉnh trung du miền núi và theo quan niệm truyền thống cổ xưa của người chăn nuơi thì muốn nuơi vịt và ngan phải cĩ ao hồ hay sơng suối nên khơng trú trọng đến việc chăn nuơi ngan vịt mà số ít hộ nuơi này chủ yếu chăn nuơi theo hướng nhỏ lẻ, tự phát và chăn thả tự do để lấy thịt và trứng Số hĩa bởi Trung tâm Học liệu – Đại học Thái Nguyên 62 phục vụ cho những bữa ăn hàng ngày, đồng thời đây là hai lồi được coi là lồi mang trùng của virus cúm, cùng với ý thức về phịng chống dịch bệnh được nâng cao nên người chăn nuơi bỏ dần chăn nuơi ngan vịt và chuyển sang chăn nuơi gà. Chỉ cĩ một số rất ít hộ chăn nuơi với quy mơ lớn mang tính hàng hố như nuơi vịt ngan thương phẩm và đẻ trứng. Mặc dù cĩ địa hình đồi núi thấp và dốc rất thuận lợi cho cơng tác vệ sinh phịng chống dịch bệnh và phát triển chăn nuơi gia cầm, đặc biệt là chăn nuơi gà nhưng với thực trạng như hiện nay thì khơng chỉ quản lý chăn nuơi mà cơng tác quản lý tình hình dịch bệnh cũng như thực hiện các biện pháp phịng chống cũng sẽ gặp rất nhiều khĩ khăn, đặc biệt là cơng tác phịng chống dịch cúm gia cầm. Tuy nhiên những năm gần đây, ngành chăn nuơi gà của tỉnh Thái Nguyên lại đang phát triển theo hướng khá tích cực, do sự tác động rất lớn của dịch cúm gia cầm với ý thức bảo vệ đàn gia cầm và sức khoẻ của chính mình mà người chăn nuơi cũng bắt đầu cĩ những xu hướng chuyển từ chăn nuơi nhỏ lẻ manh mún và chăn thả tự do sang chăn nuơi tập trung với quy mơ tăng dần. Tuy nhiên nếu các ngành chức năng khơng cĩ chủ trương và cơ chế chính sách định hướng lâu dài cho phát triển chăn nuơi tập trung thì sẽ rất dễ dẫn đến sai lệch trong sự phát triển của ngành chăn nuơi gia cầm tại tỉnh Thái Nguyên. 3.1.1.3. Phương thức chăn nuơi gia cầm ở một số huyện, thành Bảng 3.5. TỶ LỆ HỘ NUƠI GÀ Ở CÁC PHƢƠNG THỨC NUƠI Địa danh (huyện,thành) Tổng số hộ nuơi Nuơi nhốt Bán chăn thả Chăn thả

Các file đính kèm theo tài liệu này:

  • pdfdoc262.pdf
Tài liệu liên quan